Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076074 Similarity: 0.949 Similarity: 0.947 Similarity: 0.945
UTR: 5HSAA076074
Gene: PACRGL
MFE: -79.219
ENS: 0.762
Length: 195.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS0002331AB5_1263036
MFE: -61.381
Ligand: cobalamin
Species: Alistipes putredinis CAG:67 Cobalamin riboswitch
 RS: URS000231F2B5_582475
MFE: -47.902
Ligand: cobalamin
Species: Lysinibacillus xylanilyticus Cobalamin riboswitch
 RS: URS00023232EB_1121131
MFE: -58.758
Ligand: cobalamin
Species: Butyrivibrio fibrisolvens DSM 3071 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076074 URS0002331AB5_1263036 URS000231F2B5_582475 URS00023232EB_1121131
Length 195. 196. 195. 195.
Similarity - 0.949 0.947 0.945
Ensemble Norm 0.762 - - -
MFE -79.219 -61.381 -47.902 -58.758
Ligands - cobalamin cobalamin cobalamin
Gene PACRGL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.009 4.002 11.004
Length SE - 1. 0. 0.
Lev Distance - 62. 69. 67.
UBS 13. 15. 12. 13.
BS 2. 1. 2. 0.
ILL 2. 3. 1. 1.
ILR 2. 3. 3. 2.
H 4. 5. 4. 5.
BL 7. 7. 7. 6.
BR 5. 5. 4. 3.
UN 0.138 0.046 0.097 0.072

Sequences

Field Description
UTR seq + 25 auuuccccaaacgcaggcgcucgguggcgguagccgcgguuguuggccgaccgagugccggucauaagccccccccgguggggggcagcuggugugcggaucgcggcgggagagaggcgcgguaggaacggguccccggagccgugaaccgcgggagugaaagggaagcaATGCAGAAATCAGAGGGCTCTGGAG
UTR dot + 25 .((((((….(((.((((((((((.(.(.((((…….)))).)).))))))))))…(((.(((..(((((….)))))..))).)))(((((.((((((((((…..(((.((…….)).))))))…))))))).)))))…)))…))))))………..(((((….)))))..
RS 1 seq UAUAUUUGCGGCAGAUUUGGUUUCCGGCUCCUUAUGCAAGGAGAGGAAUGAAAAGGGAAUCGGGUGUGAAUCCCGGACAGUCCCGCUGCUGUGAAGCUCCGCGACGUUUCGAACAUCUCUGCCACUGGUCCGCACGGACCGGGAAGGCUUCGGAACAGGAGUGAGUCAGAAGACCUGCCAGAUCGAUUCGAUGUCA
RS 1 dot ….((((((((((.(((.(.((((..((((((….)))))).))))).))).((((.(((((…….)))))….)))).))))))))))(((.(((..(((((((((…….(((.(((((((….)))))))…))))))))))).)..))))))(((…..)))..(.((((…)))).)..
RS 2 seq AAUAUGCUAAAUUUUGGUGGUUCAAAUGAAUUUCUUUUCAUUUGAUUAAAAGGGAAGUUGGUGAGAGUCCAACACUGUCCCGCAACUGUAUUUGGAAGUUCAAUAACAAUACCACUGUUUUGGUUGCCAAAAUGGGAAGGUGUUAUUGUAGCGUUGAUCAUAAGUCAGGAGACCUGCCACUAAAGAAGCAUCAAU
RS 2 dot …(((((…(((((((((.(((((((((……)))))))))……((((.(((((…….)))))….))))…(((.(((.(.((.((((((((((…(((.(((((((((…)))))))))…)))))))))).))).)).)..))))))((((…))))))))))))).)))))….
RS 3 seq AAUGUUCCUACGUAUGUGGGUGUCGGCUACAAGUUAUCCGCUUGCAGUUGACCUAACAGGGAACCGGGCGUACAUCCCGGACAGUGCCGCUACUGUGUUGGAACAGAGGAUGCGCAUGGCUGAUGGAUACAGUCAUGAGGGCACCACCAAAAAAGUGUUCCUAAGUCAGAUACCUGCCCAUGUUGUCUUGGUGUU
RS 3 dot …((((((…..(((.((.(((((((.(((((…..))))).))))))))).)))))))))((((…….)))).((((((….))))))…(((((((.((.(((.((((((((…….))))))))…))))).)……..))))))…….((((((……………))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table