Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076188 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA076188
Gene: PADI4_0
MFE: -11.504
ENS: 0.855
Length: 54.
Predicted Ligands:
glutamine - 15/20
unknown - 5/20

 RS: URS0000C871BE_12908
MFE: -8.431
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000C4B356_12908
MFE: -9.754
Ligand: glutamine
Species: unclassified sequences Glutamine riboswitch
 RS: URS0000BF2A85_1002672
MFE: -9.054
Ligand: glutamine
Species: Candidatus Pelagibacter sp. IMCC9063 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076188 URS0000C871BE_12908 URS0000C4B356_12908 URS0000BF2A85_1002672
Length 54. 53. 53. 53.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.855 - - -
MFE -11.504 -8.431 -9.754 -9.054
Ligands - glutamine glutamine glutamine
Gene PADI4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.005 9. 9.
Length SE - 1. 1. 1.
Lev Distance - 10. 11. 11.
UBS 5. 3. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 2. 1. 0. 0.
H 2. 2. 2. 2.
BL 2. 0. 2. 2.
BR 0. 0. 2. 2.
UN 0.222 0.151 0.208 0.208

Sequences

Field Description
UTR seq + 25 uacagccagagggacgagcuagcccgacgATGGCCCAGGGGACATTGATCCGTG
UTR dot + 25 ….(((((.(((.(……))))..)..))))…..(((……)))…
RS 1 seq AUCGUUCAUCUUCGUAAGAAGACGGAAGUAGGUGAAAGCUGAAGGAACGCGAC
RS 1 dot ….(((((((((((……))))….))))))).((………))…
RS 2 seq AACGUUCAUCUUUUUUUUAAAAGACGGAAGUAGCGAAAGCGAAGGAACGCACC
RS 2 dot .((.(((.((((((….)))))).))).))…….(((……)))…
RS 3 seq AACGUUCAUCUUUUUUUAAAAAGACGGAAGUAGCGAAAGCGAAGGAACGCACC
RS 3 dot .((.(((.((((((….)))))).))).))…….(((……)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table