Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076214 Similarity: 0.963 Similarity: 0.962 Similarity: 0.960
UTR: 5HSAA076214
Gene: PAFAH1B2
MFE: -45.155
ENS: 0.960
Length: 127.
Predicted Ligands:
TPP - 8/20
cobalamin - 4/20
SAM - 3/20
RS: URS0000DB2A8E_1940
MFE: -54.234
Ligand: cobalamin
Species: Streptomyces albireticuli Cobalamin riboswitch
RS: URS00022C42B7_92647
MFE: -49.925
Ligand: glycine
Species: Paraburkholderia tropica Glycine
RS: URS0000C33E53_1489678
MFE: -51.056
Ligand: glucosamine
Species: Deinococcus sp. RL glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076214 URS0000DB2A8E_1940 URS00022C42B7_92647 URS0000C33E53_1489678
Length 127. 127. 128. 125.
Similarity - 0.963 0.962 0.960
Ensemble Norm 0.960 - - -
MFE -45.155 -54.234 -49.925 -51.056
Ligands - cobalamin glycine glucosamine
Gene PAFAH1B2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 14.003 19.004
Length SE - 0. 1. 4.
Lev Distance - 44. 42. 37.
UBS 13. 13. 11. 10.
BS 0. 0. 0. 0.
ILL 0. 2. 2. 0.
ILR 3. 2. 2. 3.
H 4. 3. 3. 3.
BL 8. 6. 6. 5.
BR 4. 5. 4. 4.
UN 0.071 0.063 0.125 0.136

Sequences

Field Description
UTR seq + 25 cgcgccggagcgggaccgacgggaccgagcgagcgaccgacgcgccacccgccgacgccucagccgcuuggggcccgcacggacccucuacuucaguguagaATGAGCCAAGGAGACTCAAACCCAG
UTR dot + 25 (((……)))((.(((.((((.(((((((.((((.((.((.((…..)))).))..)).)))))))))..))))..))).)).(((((……))))).((((.(…..).))))…….
RS 1 seq AGAGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUCACCGGGGAGCGUCCUCCACCGAGGGCCACGGUCCGCCUGCCGGACCGGAAGGCCGGAACGACGCCGAUCCGGGAGCCAGGAGACUC
RS 1 dot ……..((..(.((.(((((((((((.((.(((.((…..(((((((….)))).))))))))…)).))))..))))))))).).))(((((.((….)).)))))(((……..)))
RS 2 seq GUCCGCAACUCUGGAGAGCGGCAGUAGAACGGCGGAGGGAUCGUAACCCUGGCGUUCAGGCUGCCCACCGAAGGGGCGCGCGUCUUUCCCGACGCAAUCUCUCAGGUACCGAGGACAGAGGGGCCAUG
RS 2 dot …(((..((.(((…(.((((((.(((((.(((.((……..))))).)))))..))))))).))).))..))).(((((……)))))………(((.((………)).)))…
RS 3 seq GCGAACAGGGCAGCGCAAGGUCUGCCUCUCCCCUGGACAGGCAGAAGACGAGGUGGAGGUCAGCGAAGAUUCUGCGGAUGCCUCCAGGCCCCGGCACGGGCCUACCCGACCGCUGAUGCGGUGAA
RS 3 dot …….(((((.((((.(((((((.((((((((.(.(……..).).))).)))))…))..))))).))))..)))))..((((((……))))))…..(((((….)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table