Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076250 Similarity: 0.980 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA076250
Gene: PAGE4
MFE: -21.391
ENS: 0.974
Length: 92.
Predicted Ligands:
TPP - 6/20
SAM - 4/20
zmp-ztp - 4/20
 RS: URS0000DA6DDE_1918949
MFE: -27.977
Ligand: TPP
Species: Solemya elarraichensis gill symbiont TPP riboswitch (THI element)
 RS: URS0000C1769C_1423804
MFE: -16.776
Ligand: SAM
Species: Lactobacillus similis DSM 23365 = JCM 2765 SMK box translational riboswitch (SAM-III)
 RS: URS0000ABD22D_298654
MFE: -43.096
Ligand: cobalamin
Species: Frankia sp. EuI1c Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076250 URS0000DA6DDE_1918949 URS0000C1769C_1423804 URS0000ABD22D_298654
Length 92. 92. 90. 92.
Similarity - 0.980 0.980 0.980
Ensemble Norm 0.974 - - -
MFE -21.391 -27.977 -16.776 -43.096
Ligands - TPP SAM cobalamin
Gene PAGE4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.006 6. 4.
Length SE - 0. 4. 0.
Lev Distance - 25. 20. 26.
UBS 7. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 1. 1. 3.
H 2. 2. 2. 2.
BL 3. 2. 1. 2.
BR 2. 2. 2. 1.
UN 0.120 0.196 0.133 0.141

Sequences

Field Description
UTR seq + 25 ugacacugcugaggucuaaacaaggaggcagaaguagucuucaguucacgaucuucuaguugcagcgATGAGTGCACGAGTGAGATCAAGAT
UTR dot + 25 (((.((((((…((((……..))))…))))))..)))……((((((((.(.((((……..))))).)).))))))…..
RS 1 seq UCUGCGAGCUAGGGGUGACCAUUUUGGGCUGAGAUACACCCUUUGCACCUGAUCCGGUUAAUGCUGGCGGAGGAAAGCUGCGGGAGCCGUAA
RS 1 dot …….((.(((((((…(((((…..))))).))))))).))……..(((((..(((.(((……..))))))..)))))…
RS 2 seq UAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUCUAGUGAAGAUGCCUUGUAACCGAAAAACGAAUUGGGGGAAUUUUUUAUG
RS 2 dot …((((((((((((((……))..))))))).)))))…..((((((.(((…..((((……..))))))).))))))….
RS 3 seq AGGGGAACUCCGGUGCGGCGCUGGGUGCCAAGACCGGGGCGGUCCCGCCACUGUGAGCCGCGGCCGGUCCGGCGCGGUGAGCCAGAACACCU
RS 3 dot ..((((.(((((((..(((((…)))))…)))))))…))))….((((..(((((.((((…)))))))))..)).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table