Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076340 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA076340
Gene: PAK3
MFE: -5.699
ENS: 0.826
Length: 52.
Predicted Ligands:
unknown - 19/20
cobalamin - 1/20

 RS: URS0000D66804_12908
MFE: -18.335
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000D69992_311402
MFE: -15.321
Ligand: unknown
Species: Agrobacterium vitis S4 sul1 RNA
 RS: URS0000E5FF62_1881059
MFE: -19.927
Ligand: unknown
Species: Aurantimonas sp. USBA 369 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076340 URS0000D66804_12908 URS0000D69992_311402 URS0000E5FF62_1881059
Length 52. 52. 53. 53.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.826 - - -
MFE -5.699 -18.335 -15.321 -19.927
Ligands - unknown unknown unknown
Gene PAK3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.003 2. 2.002
Length SE - 0. 1. 1.
Lev Distance - 12. 12. 12.
UBS 2. 2. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 0. 0. 1. 1.
BR 0. 0. 0. 0.
UN 0.346 0.288 0.340 0.302

Sequences

Field Description
UTR seq + 25 gagcugugaaauuaguuguaacugaaaATGTCTGACGGTCTGGATAATGAAG
UTR dot + 25 .(((((……)))))………..(((((……..)))))……
RS 1 seq GGGUCCGGGAUCAUUUUCCGGAGGGUGUUUAAGAUGGUCGGGCCGCCAUCCU
RS 1 dot …(((((((…..)))))))……….((((((……))))))..
RS 2 seq AUCGGACUCGUUUUGACGAGUGGCUUCUCCGGGCGCCUAUCCCCCGGCCACAG
RS 2 dot …..((((((….))))))…….(((((.(……))))))……
RS 3 seq CAAGGACCCAUUCAGUUGGGUGGCUACGCCGGGCGCCGAUCCCCCGGCCAACU
RS 3 dot …..(((((……)))))……((((((.(……)))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table