Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076470 Similarity: 0.951 Similarity: 0.951 Similarity: 0.949
UTR: 5HSAA076470
Gene: PAM
MFE: -25.702
ENS: 0.986
Length: 153.
Predicted Ligands:
glucosamine - 13/20
FMN - 2/20
SAM - 2/20
 RS: URS0000DAAA2A_1450648
MFE: -35.653
Ligand: glucosamine
Species: Clostridium oryzae glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BFBCF3_1262811
MFE: -26.288
Ligand: glucosamine
Species: Clostridium sp. CAG:465 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB94FC_572544
MFE: -33.511
Ligand: glucosamine
Species: Ilyobacter polytropus DSM 2926 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076470 URS0000DAAA2A_1450648 URS0000BFBCF3_1262811 URS0000AB94FC_572544
Length 153. 153. 154. 154.
Similarity - 0.951 0.951 0.949
Ensemble Norm 0.986 - - -
MFE -25.702 -35.653 -26.288 -33.511
Ligands - glucosamine glucosamine glucosamine
Gene PAM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.068 9.076 16.076
Length SE - 0. 1. 1.
Lev Distance - 63. 62. 63.
UBS 4. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 1. 1. 1.
H 3. 4. 4. 4.
BL 0. 1. 1. 2.
BR 1. 0. 0. 1.
UN 0.542 0.281 0.266 0.266

Sequences

Field Description
UTR seq + 25 auaacagcucgaagaauaaaauauaaggauacaucagugucgaggagaagcagaucauagacuguaauagcucacaaggaaacacugagcuguauacaaacgccucauaauuacuuuauuaaauauuuATGGCTGGCCGCGTCCCTAGCCTGC
UTR dot + 25 ………………………(((((….)))))…………………((((((((((((………..)))))))).))))…………………………..((((((……..))))))…
RS 1 seq UUAAUAUUUAUAGCGCCAGAACUUAGGGCCUACUUAAGUUGACGAGGAUGGGGAGUAUCGAAAAUUCGGCGGAUGCCCCACGGUACACACUACCGUUAAAGUUUAGUAAAACUCAGGAAGUGAUUUCUGCAACAACACUAAACAGGUGUAUUC
RS 1 dot ……………….((((((((…..))))))))……….(((.(((((…………))))))))((((((…..))))))….(((((((……((((((….))))))…….)))))))……….
RS 2 seq UAACAUUAAAUAGCGCAUGAACAUACCUUUCGUAUGUGACGAGGAUGAUAGUUAUCGAACAUUCAGCGGAUACUAUCACGGUGAUUUAGCAUCGAUAUAUAUAGUACAAAAAGUAAAAUCUUUAAUUACUACAAAAACUAUAUAAUCUAAAUAU
RS 2 dot ………………..((((((…..))))))……..((((((.((((…………))))))))))(((((……)))))…((((((((……(((((………)))))……))))))))……….
RS 3 seq AAAAUAAAAAAAGCGCCAGAGCUUAUGAUCUUAUAAGCUGACGAGGAACGGAGUUAUCGAAAAUUCGGCGGAUGCUCCGAAGGUGGUUACAACCUCAGUAACGUUACAAAUUCAAAGAGUGAUCUUUGGGACAAAAGACGUUUCAGUAGCAUUU
RS 3 dot ……………….((((((((….))))))))………(((((.((((…………))))))))).((((…….))))..(.((((((…..((((((((….))))))))……)))))).)……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table