Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076504 Similarity: 0.981 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA076504
Gene: PAM_0
MFE: -22.759
ENS: 0.864
Length: 93.
Predicted Ligands:
SAM - 8/20
glycine - 7/20
Ni/Co - 3/20
 RS: URS0000B4951C_191216
MFE: -31.368
Ligand: glycine
Species: uncultured Microbacterium sp. Glycine
 RS: URS0000C5D479_861450
MFE: -21.334
Ligand: glycine
Species: Anaeroglobus geminatus F0357 Glycine riboswitch
 RS: URS0000DA3B31_47858
MFE: -29.785
Ligand: glycine
Species: Micromonospora echinofusca Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076504 URS0000B4951C_191216 URS0000C5D479_861450 URS0000DA3B31_47858
Length 93. 93. 92. 93.
Similarity - 0.981 0.978 0.978
Ensemble Norm 0.864 - - -
MFE -22.759 -31.368 -21.334 -29.785
Ligands - glycine glycine glycine
Gene PAM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 3. 4.004
Length SE - 0. 1. 0.
Lev Distance - 25. 27. 28.
UBS 5. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 0. 0. 0. 0.
H 4. 4. 4. 4.
BL 1. 0. 1. 0.
BR 0. 0. 1. 1.
UN 0.183 0.194 0.163 0.247

Sequences

Field Description
UTR seq + 25 ucaggggaacuugaugaaaagcaugaaccacuagcuuaaaguugggaaaguccgauacauacuucugcATGGCTGGCCGCGTCCCTAGCCTGC
UTR dot + 25 (((((….)))))….((((………..))))…((((((….))))))……….(((.((((((……..)))))))))
RS 1 seq CCGCUCUGAAAAGCGAUUCUUCGAAUCCGCCGACGGUGAAAGCCGGGCCUGUGCGCCCGGUGAAGCUCUCAGGCCCAUGACAGAGGGGGAGUU
RS 1 dot .((((……))))…………((((…))))…(((((((……)))))))..((((((….(((……..)))))))))
RS 2 seq GGACAUAUCUCUGGAGAGUCCCUAACGGGCGCCGAAGGUGCACGAAGUACCAGUACUUCUUAUCUCUCAGGCAAAAGGACAGAGCUUAGGAU
RS 2 dot ((((…(((….)))))))…….(((((…)))))..((((((….))))))…..(((.((((………..)))).))).
RS 3 seq CGAACCCGCGCGGGAGAGAUCCCGACCGUCCGUCGGGGCGCCGAAGGAGCAAACUCCCAAGAAACUCUCAGGCCCCGUUACCGCUCGGGUGAG
RS 3 dot ………((((((….))))).)(((((….)))))…..((((….))))………((((…((((……..))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table