Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076800 Similarity: 0.989 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA076800
Gene: PARP15
MFE: -8.890
ENS: 0.964
Length: 57.
Predicted Ligands:
unknown - 10/20
glutamine - 6/20
preQ_1 - 1/20
 RS: URS0000D68DA4_12908
MFE: -18.193
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000D65DBF_314231
MFE: -23.657
Ligand: unknown
Species: Fulvimarina pelagi HTCC2506 sul1 RNA
 RS: URS0000E600D1_173675
MFE: -21.082
Ligand: unknown
Species: Sphingopyxis witflariensis sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076800 URS0000D68DA4_12908 URS0000D65DBF_314231 URS0000E600D1_173675
Length 57. 56. 56. 56.
Similarity - 0.989 0.989 0.988
Ensemble Norm 0.964 - - -
MFE -8.890 -18.193 -23.657 -21.082
Ligands - unknown unknown unknown
Gene PARP15 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.012 4.003 2.003
Length SE - 1. 1. 1.
Lev Distance - 13. 13. 15.
UBS 3. 2. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 1. 1.
H 2. 2. 2. 2.
BL 0. 0. 1. 0.
BR 1. 0. 0. 0.
UN 0.158 0.268 0.107 0.107

Sequences

Field Description
UTR seq + 25 auuguuaucaacucuuugauaucugaugaucaATGCTCCAAAGAATTGGATTAATAT
UTR dot + 25 ((((((((((………….)))))).))))..(((((….)))))…….
RS 1 seq GGGUGCAGAUGAAUAUCAAGUAAUCUGCAGGUUUUUGGGUGGUCGGGCCGCCAUCC
RS 1 dot …(((((((…………)))))))……..((((((…))))))….
RS 2 seq CAUGGACCCGCAUCUUCCGCGGGUGGCUAUGCCGGGCGCCUAUCCCCCGGCCCAUC
RS 2 dot (((((((((((…….))))))..)))))(((((.(……))))))……
RS 3 seq AAUGGACCCGGUGCAACUCCGGGUGGCUAUUCCGGCCGCCGAUCCGCCGGACAACA
RS 3 dot (((((((((((…….))))))..)))))(((((………)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table