Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA076812 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA076812
Gene: PARP2
MFE: -27.772
ENS: 0.704
Length: 85.
Predicted Ligands:
GMP - 12/20
cyclic-di-GMP - 6/20
glycine - 1/20
 RS: URS0000AB8D2C_292415
MFE: -23.094
Ligand: glycine
Species: Thiobacillus denitrificans ATCC 25259 Glycine riboswitch
 RS: URS0002334E12_1588020
MFE: -23.398
Ligand: zmp-ztp
Species: Arthrobacter sp. Hiyo1 ZMP/ZTP riboswitch
 RS: URS0000D68CBD_12908
MFE: -43.538
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA076812 URS0000AB8D2C_292415 URS0002334E12_1588020 URS0000D68CBD_12908
Length 85. 87. 85. 85.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.704 - - -
MFE -27.772 -23.094 -23.398 -43.538
Ligands - glycine zmp-ztp GMP
Gene PARP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.011 3.005 14.
Length SE - 4. 0. 0.
Lev Distance - 21. 28. 24.
UBS 8. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 1. 3. 1. 2.
ILR 3. 4. 3. 1.
H 3. 2. 2. 2.
BL 2. 2. 3. 4.
BR 1. 1. 2. 3.
UN 0.024 0.126 0.094 0.024

Sequences

Field Description
UTR seq + 25 cuagugacacugggcccgcgauuccuuggagcggguugaugacgucagcguucgaauuccATGGCGGCGCGGCGGCGACGGAGCA
UTR dot + 25 (((((…)))))(.(((((…((.((((((((((((((…))))))..)))..))))).))…)))))).((……)).
RS 1 seq GUUCCCGUUGCGGGAGAGCGCAGCCCAGCCUGCCGCCGAAGGCGUAAUCACCCGGAAUCGCUCAGGCAAAAGGACCGCAACACCCAG
RS 1 dot .((((((…)))))).(((…((..(((((.(((((..((.(….).)))))…))..)))))….))..)))………
RS 2 seq UUAAGUCGUCGCGACUGGCGUUGGGUGGUGCACCACCAGGGAGCGGCAUUUUGAAGACCACGGAUCGUACGCCUGGGCCGAGGGU
RS 2 dot ……(((.(((((((..((((((((.(((.((….))..))).)))))….)))..))).)))))))(((……)))..
RS 3 seq CGGUUGGCGGGAGGCUCUGACACGCGGUCCACAUCCCGGCCGCCGGGACCGCGCCGAGCCGCUGGCGAGACCGACCCGCGAGGGA
RS 3 dot (((((.((.((.(((((.(…(((((……((((((…)))))))))))).))))).)).))..))))).(((….))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table