Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077031 Similarity: 0.985 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA077031
Gene: PAX1
MFE: -22.227
ENS: 0.841
Length: 79.
Predicted Ligands:
SAM - 16/20
fluoride - 2/20
zmp-ztp - 1/20
 RS: URS00001001E5_483908
MFE: -22.170
Ligand: SAM
Species: Paenibacillus sp. P22 SAM-I/IV variant riboswitch
 RS: URS0000DA2B20_1895723
MFE: -20.042
Ligand: SAM
Species: Bosea sp. 67-29 SAM riboswitch (alpha-proteobacteria)
 RS: URS0002320C2B_1385520
MFE: -31.906
Ligand: zmp-ztp
Species: Knoellia sinensis KCTC 19936 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077031 URS00001001E5_483908 URS0000DA2B20_1895723 URS0002320C2B_1385520
Length 79. 78. 78. 79.
Similarity - 0.985 0.985 0.984
Ensemble Norm 0.841 - - -
MFE -22.227 -22.170 -20.042 -31.906
Ligands - SAM SAM zmp-ztp
Gene PAX1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7. 9.008
Length SE - 1. 1. 0.
Lev Distance - 18. 17. 18.
UBS 6. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 3. 1.
ILR 1. 1. 1. 1.
H 2. 2. 1. 2.
BL 1. 2. 1. 3.
BR 3. 2. 4. 4.
UN 0.165 0.192 0.179 0.076

Sequences

Field Description
UTR seq + 25 aaauugauucccgcacgcugcagccucccggucagacgaauuucucccaaucggATGAAGTTCACCCTGGGCCTGGGGT
UTR dot + 25 …………((……..))((((.((((((..((((((((((…..))).)))))))…)))).)).)))).
RS 1 seq AUCAAGAGUAGGCGGAGGGACCAGCCCGAUGAAGCCCGGCAACCGGCGUGCGAACGCACGGUGCUAAUUCUUGCGGAU
RS 1 dot ……….(((((…..)).)))(((.(((….(((.((((((((….)))).)))))))..))))))…..
RS 2 seq AACAGAACACGCGCCGAUUUGAGCCACCAGCUUGCGGGCGCGAAAUAAAUGCAGCUAAAGCGUGGGGAAGGGCGGCAG
RS 2 dot …………((((..((…((.(((((((…((((((…….))).))).)))).))))).))..))))..
RS 3 seq AUCGGGCGCGACGACUGGCGCGGGUGGACCACCACCGGGGAGUCACAUGGGAGUUGCAUCGCCCGCCUGGGUGCACCCG
RS 3 dot ……(((……..)))((((((.(((.(…((((((((.((……)).)).)).))))…)))).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table