Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077049 Similarity: 0.974 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA077049
Gene: PAX3
MFE: -24.120
ENS: 0.992
Length: 105.
Predicted Ligands:
TPP - 6/20
purine - 5/20
glycine - 5/20
 RS: URS0000AB6DED_526986
MFE: -17.836
Ligand: purine
Species: Bacillus cereus Rock3-44 Purine riboswitch
 RS: URS0000C7A037_1677858
MFE: -16.099
Ligand: purine
Species: Propionispora sp. 2/2-37 Purine riboswitch
 RS: URS0000AB3317_886882
MFE: -18.667
Ligand: purine
Species: Paenibacillus polymyxa SC2 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077049 URS0000AB6DED_526986 URS0000C7A037_1677858 URS0000AB3317_886882
Length 105. 104. 102. 104.
Similarity - 0.974 0.973 0.972
Ensemble Norm 0.992 - - -
MFE -24.120 -17.836 -16.099 -18.667
Ligands - purine purine purine
Gene PAX3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.007 3.005 8.004
Length SE - 1. 9. 1.
Lev Distance - 30. 24. 33.
UBS 7. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 0. 1. 0.
ILR 3. 1. 3. 2.
H 2. 3. 2. 3.
BL 3. 3. 2. 2.
BR 1. 2. 1. 1.
UN 0.343 0.260 0.275 0.279

Sequences

Field Description
UTR seq + 25 uaaauuuuaaauuaaauccauaggucugguuuagcaaccgccgugcaagauggaggaagcaagcuggggccaaucaacugATGACCACGCTGGCCGGCGCTGTGC
UTR dot + 25 ………………….(((((.((((.((..((.((((…..)))).))..))))))..)))))…………((..((((….))))..))..
RS 1 seq AUCAUCUUAAAUAUCAUUACUCGUAUAUACUCGGUAAUAUGGUCCGAGCGUUUCUACCUAGUUCCCAAUGAAAGAACUAGACUACGGGUUAAAGUAAUCGGUUG
RS 1 dot ………………….(((.((.(((((………))))).))…)))(((((((………)))))))…((.(((((…))))).))..
RS 2 seq AUAGCGUAAGUUCAUACUGCUCGUAUAAAUUUGAGGAUAUGGCUCAAAAGUUUCUACCAGGCGACCGUAAAUUACCUGACUACGAGUGAAAUUGUACCUAGG
RS 2 dot ……………..((((.(((.(((((((((…….)))))..)))).)))..))))………..((((..(((((……)))))..))))
RS 3 seq AGAUAUCAAUUUCAUAUGACUCGUAUAAUAUUGGGGAUAUGGCCCAAAAGUUUCUACCGGAUGACCACUGUAAUCGUCCGACUAUGAGUGAUAGCGCAUCAGCU
RS 3 dot ………………….(((.(((.(((((…….)))))..)))..)))(((((((………)))))))….((((((….))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table