Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077087 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA077087
Gene: PBLD
MFE: -34.832
ENS: 0.886
Length: 169.
Predicted Ligands:
lysine - 7/20
Mg2+ - 6/20
cobalamin - 5/20
 RS: URS000232B5EB_61635
MFE: -37.254
Ligand: cobalamin
Species: Acholeplasma brassicae Cobalamin riboswitch
 RS: URS000231A84F_107327
MFE: -39.655
Ligand: cobalamin
Species: Pseudoalteromonas ulvae Cobalamin riboswitch
 RS: URS0000C7DAC4_1157490
MFE: -57.816
Ligand: FMN
Species: Tumebacillus flagellatus FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077087 URS000232B5EB_61635 URS000231A84F_107327 URS0000C7DAC4_1157490
Length 169. 171. 169. 169.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.886 - - -
MFE -34.832 -37.254 -39.655 -57.816
Ligands - cobalamin cobalamin FMN
Gene PBLD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.019 19.001 11.001
Length SE - 4. 0. 0.
Lev Distance - 57. 60. 63.
UBS 7. 8. 10. 9.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 1.
ILR 1. 0. 3. 3.
H 5. 7. 6. 5.
BL 1. 1. 0. 2.
BR 1. 0. 1. 0.
UN 0.166 0.304 0.136 0.195

Sequences

Field Description
UTR seq + 25 guuacagugagccgagaucggugccacugcacucccgccugggcaacagagcaagacuccaucucaaaaaaugaaaaaagaaaagaagacguaaagcaggcuaccagcaauuuugagaacuugcaaaaacagcuugcaaggaaaATGAAGCTTCCTATTTTCATAGCAG
UTR dot + 25 ….(((((.((((….))))..)))))…….(((((…..))).))………((((((((…………………………………..)))))))).(((((((…….)))))))(((((((……..)))))))…….
RS 1 seq UUAACUUAAUGGGUAUUAGGUGUCUUAGGACAUAACAGGGAAGAAAGUAAAAGCUUUCGCUGCCCCAGCAACCGUAAAACGGACAAAUCACAUAAGCCACUGCGACUAAGCGGGAAGGCGUGAGGCGGAUGAUGUCUUAGCCGGUAGACCUACCUUUUAUCUACUUUUGUA
RS 1 dot …(((((((….)))))))…………………((((((….))))))((((…))))..((((…))))……………..((((……))))…(((.(((((((…..))))))))))((((((………..))))))……
RS 2 seq AGCAGAACCUUUAAUUAAGGUGCCAAUGAAGCUUCAUUUUAUUAUGUAAGCUUUUGAGGAUAAUCGGGAAGUUGGUGAGUUCAUAUCCAACACUGCCCCCGCAACGGUGAGCGUGAUAAAUAAAUAUUUAUCCGACAGUCCGGAGACCGGCCUUAAUUGUCAUUCAGUU
RS 2 dot ……(((((…..))))).((…((((((((((……))).)))))))…))……(((..(((((………..)))))…..)))(((……..))).(((((((….))))))).((((((((((…))))…..))))))……..
RS 3 seq AAAUACCUUCGGGGCAGGGUGAAAUUCCCGACCGGCGGUGAUGACCCCCCGAUGGGGUCUCAGCCCGCGACUCCCUUUGCACAAGUUUGUUUUUUCGUUGUGCGUGCAGAGGGACUGACUUGGUGCAACUCCAAGGCCGACGGUACAGUCCGGAUGGAAGAAGGGUAAA
RS 3 dot …………((..(((…….)))..)).(((((((.((((((…..)))))))))..))))…(((((((((((…………………)))))))))))….(((((…….))))).(((.(((……)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table