Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077434 Similarity: 0.955 Similarity: 0.955 Similarity: 0.955
UTR: 5HSAA077434
Gene: PCBP3
MFE: -33.020
ENS: 0.846
Length: 150.
Predicted Ligands:
SAM - 14/20
cobalamin - 2/20
FMN - 2/20
 RS: URS000232ED24_1618778
MFE: -30.044
Ligand: cobalamin
Species: Candidatus Nomurabacteria bacterium GW2011_GWF2_43_24 Cobalamin riboswitch
 RS: URS0000D93DE0_66430
MFE: -64.250
Ligand: SAM
Species: Streptomyces roseus SAM riboswitch (S box leader)
 RS: URS0000C7AAC3_698760
MFE: -67.833
Ligand: SAM
Species: Streptomyces turgidiscabies Car8 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077434 URS000232ED24_1618778 URS0000D93DE0_66430 URS0000C7AAC3_698760
Length 150. 150. 150. 152.
Similarity - 0.955 0.955 0.955
Ensemble Norm 0.846 - - -
MFE -33.020 -30.044 -64.250 -67.833
Ligands - cobalamin SAM SAM
Gene PCBP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9.030 17.004 4.002
Length SE - 0. 0. 4.
Lev Distance - 57. 54. 54.
UBS 9. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 3.
ILR 4. 2. 5. 5.
H 3. 4. 3. 3.
BL 2. 3. 4. 2.
BR 0. 1. 2. 1.
UN 0.080 0.253 0.140 0.125

Sequences

Field Description
UTR seq + 25 gucgguaggcuccacgacaaaagucaacccuucuguaaaucaccugcugugguuaugaugcucugaguucaauacgucugaaccuuugcugucuauggaucugcucuaaaccuuauagccugcuuATGGGGGAAGGTGACGCCTTCTGGG
UTR dot + 25 …((((((.((((.((((……………………..((…((((..((((…((….))…))))..))))…))))))..))))))))))…..((((((((…..))))))))((((((…))))))….
RS 1 seq GUAAGUAUAUACUAAAUAGGUUCGUUUAAAAAUCAAAAGAAGUGAUUGGGGAAACCGGUUAGAUUCCGGUACAGUGCCGCUACGGUAAGUCCCGAACACCAACAGGUGGAGGGAACAAGUCCGACUAUCAAUCAUUUUACGUGUCCCGUA
RS 1 dot ………………((((……..))))…….(((.((.((((.((((..(((….(((((…))))))))))))…)))).)))))…..(((((..(((…..)))..)))))……..((((…..))))
RS 2 seq CGCUCAUCCAGAGGGGCAGAGGGACACGGCCCGUUGAAGCCCCGGCAACCCUCCAGUCGGUUCUCGCGAUCGCUUGCGGCAGCGAGGUCCCCGGCUAGGGAAGGUGCCAAUUCCGUCUCAUGGCGAAGUGCGCCAUGGGGAAGAUGAGGA
RS 2 dot …………(((((((.(((……))).))…)))))(((.(((.(((((((((.((((((..(((….)))..))))))…))))))..))).))))))…((..((((((((((…..))))))))))..))……
RS 3 seq CGCUCAUCCAGAGGGGCAGAGGGAUACGGCCCGAUGAAGCCCCGGCAACCCUCCAGUCGGCACUCGUGAUCCAUUGACGGAUCGCGAGGCUCCCGGCUCGGGAAGGUGCCAAAUCCGUCUCAUGGCGAAACGCGUCGUGAGAAAGAUGAGGA
RS 3 dot …………((((((..(((……)))..)…)))))(((.(((.(((((((((..((((((((((……))))))))))….))))))..))).))))))..(((..((((((((((…..))))))))))..)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table