Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077585 Similarity: 0.982 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA077585
Gene: PCCB
MFE: -32.756
ENS: 0.780
Length: 95.
Predicted Ligands:
SAM - 7/20
glycine - 6/20
TPP - 5/20
 RS: URS00019F7FDE_2653151
MFE: -26.017
Ligand: TPP
Species: Marinoscillum sp. 108 TPP
 RS: URS0000C32545_196109
MFE: -25.637
Ligand: TPP
Species: Microdochium bolleyi TPP riboswitch (THI element)
 RS: URS0000C7EB60_1660131
MFE: -37.501
Ligand: SAM
Species: Pseudonocardia sp. SCN 72-86 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077585 URS00019F7FDE_2653151 URS0000C32545_196109 URS0000C7EB60_1660131
Length 95. 96. 96. 95.
Similarity - 0.982 0.980 0.980
Ensemble Norm 0.780 - - -
MFE -32.756 -26.017 -25.637 -37.501
Ligands - TPP TPP SAM
Gene PCCB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.003 5.001 10.
Length SE - 1. 1. 0.
Lev Distance - 21. 23. 22.
UBS 10. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 4. 4. 4.
ILR 3. 3. 3. 2.
H 1. 1. 1. 1.
BL 2. 3. 4. 4.
BR 3. 2. 3. 5.
UN 0.032 0.083 0.062 0.021

Sequences

Field Description
UTR seq + 25 agcgccguacccacgcuuuagcacaugcguacucaggugcgccgguaggggacgcgccggcacagcaaaaATGGCGGCGGCATTACGGGTGGCGG
UTR dot + 25 ..((((..((((..(((…((.(((((((.((..((((((((……)).)))))))).)).)))….))))…)))…..)))))))).
RS 1 seq GAAGUAACCACGGGGUGCCGUUAUUCGGCUGAGAUGAUACCCGUUGAACCUGAUCUGGGUAAUGCCAGCGUAGGAAUAUCGGUUGACUCGUAGUAA
RS 1 dot ……((.(((((..((((.(((((.((((..((..((((((..((……))))))))))..))))….))))).))))…))))).))..
RS 2 seq AAGGGGGAGAGCUGGAUGACAUUGGGCGUGGCUGAGAUCAUACGGCCUUAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCUCACCCCAAAU
RS 2 dot ..((((..((((..(((..(.((..((.(((.(.((((((………….)))))).)……)))))..))).)))..)))).))))….
RS 3 seq GUGCCAUCCAGAGCGGCCGAGAGACCUGGCUCGUCGACGCCGCAGCAACCACGUCCGGUUUUCGGGCGGGGUGCUUCCGCCGGGACCGAUGGGAG
RS 3 dot .(.(((((…..((((.(((..((((.(((((..((.((((..((……)).)))).))))))).))))..))).))))…..))))).).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table