Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077624 Similarity: 0.953 Similarity: 0.952 Similarity: 0.950
UTR: 5HSAA077624
Gene: PCDH18
MFE: -36.834
ENS: 0.742
Length: 187.
Predicted Ligands:
cobalamin - 14/20
FMN - 4/20
lysine - 2/20
 RS: URS0002316442_1168034
MFE: -48.055
Ligand: cobalamin
Species: Draconibacterium orientale Cobalamin riboswitch
 RS: URS0000C28895_351671
MFE: -49.899
Ligand: FMN
Species: Xenorhabdus doucetiae FMN riboswitch (RFN element)
 RS: URS000232BBD8_1415775
MFE: -28.718
Ligand: cobalamin
Species: Clostridium baratii str. Sullivan Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077624 URS0002316442_1168034 URS0000C28895_351671 URS000232BBD8_1415775
Length 187. 186. 188. 187.
Similarity - 0.953 0.952 0.950
Ensemble Norm 0.742 - - -
MFE -36.834 -48.055 -49.899 -28.718
Ligands - cobalamin FMN cobalamin
Gene PCDH18 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.006 6.003 20.002
Length SE - 1. 1. 0.
Lev Distance - 58. 61. 58.
UBS 11. 12. 12. 12.
BS 0. 0. 0. 0.
ILL 3. 1. 4. 3.
ILR 0. 2. 1. 4.
H 6. 7. 5. 5.
BL 2. 2. 3. 1.
BR 2. 2. 3. 3.
UN 0.241 0.161 0.186 0.198

Sequences

Field Description
UTR seq + 25 guauaaaacaaaaguuugcgagcuguuaauugcugugcuguguuauuaagagacgcuuucaaguuucaaguaccaaauguagcuuuacguugccaaaggaaguugaggcaauugcuuugcuguuuuaacuugcucugugagggaaaucucauaaacugaccaATGCACCAAATGAATGCTAAAATGC
UTR dot + 25 ……((((..(((..((.(((……..)))))))).))))…..(((((……..)))))………..(((((…..)))))…((.(((((((((((…((…))))))))))))).)).(((((((….)))))))………..(((………)))……..
RS 1 seq UUUAUCUUUGUGCGCGUUGGUUACGCACAAUUGCGUUUAGGGAAUCCGGUGUAAAUCCGGAACUGUACCCGCAGCUGUAAAUUCAGAAAAUGAUCAUUUCUCACGCCACUGUCGGUUCAGCCAAUGACGGGAAGGCAAUGAUCAAAGGGAAUAAGUCAGAAGACCUGCCAGCAAAUGGAUGAACGA
RS 1 dot ….((((((.((((((((……..)))).)))).)))))).(((((…….))))).((((….))))(((……)))….((((((((……(((.((((((((…)))…)))))…)))))))))))…………(((…..)))(((…..)))……..
RS 2 seq GUUUAUCUCAGGGCAGGGUGAAAGUCCCUACCGGCGGUAACAUAAAAUAGCGUGAUCAUUUUAUGCAGCCCGCGAGCGCUCUGUUUGUUGCUCUCCUUGAAGAGAAAUCGUCGGGGAUAAAACAGAGGUCAGCAGAUCCAGUGUGAUUCUGGAGCCGACGGUGAUAGUCCGGAUGGGAGAGAAUAACA
RS 2 dot ………..((.((((…….)))).)).((((…((((((((………))))))))….))))…..(((((((..(((…(((((((.((….)).)))))))))))))))))(((.((…(((((…….))))))).)))……..(((…..)))……….
RS 3 seq AAAUAUAUAUAAAUAAUAGGUUUCUAAAAUUUAUAUUUUAGUAAAAGGGAAAGUGGUUAGAAUCCACUACAGCCCCCGCUACUGUAAUAGCAGAUGAAUCUCAAUGUAUCCACUGGUUUAUAUACUGGGAAGGAAGAGAGGAGGAUGAAGCUUAAGUCAGGAUACCUACCUAUUAUUAAUUAAAUCC
RS 3 dot ……((((((((..(((….)))..))))))))..((((….(((..(((((…….)))))….)))..))))((((….))))…..(((((.(((((((…))…))))).)))))……..((((((((……………)).))).)))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table