Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA077658 Similarity: 0.985 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA077658
Gene: PCF11
MFE: -11.449
ENS: 0.650
Length: 57.
Predicted Ligands:
unknown - 16/20
glutamine - 3/20
fluoride - 1/20
 RS: URS0000E6016B_1660169
MFE: -27.885
Ligand: unknown
Species: Xanthomonadaceae bacterium SCN 69-320 nhaA-I RNA
 RS: URS0000E60322_1315974
MFE: -19.750
Ligand: unknown
Species: Sphingobium sp. TKS nhaA-I RNA
 RS: URS0000D6A6E8_272943
MFE: -20.158
Ligand: unknown
Species: Rhodobacter sphaeroides 2.4.1 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA077658 URS0000E6016B_1660169 URS0000E60322_1315974 URS0000D6A6E8_272943
Length 57. 56. 58. 57.
Similarity - 0.985 0.985 0.984
Ensemble Norm 0.650 - - -
MFE -11.449 -27.885 -19.750 -20.158
Ligands - unknown unknown unknown
Gene PCF11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.020 7.001 3.
Length SE - 1. 1. 0.
Lev Distance - 18. 17. 20.
UBS 5. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 0. 0. 1. 0.
H 2. 3. 2. 2.
BL 1. 1. 1. 1.
BR 2. 1. 0. 1.
UN 0.158 0.018 0.190 0.140

Sequences

Field Description
UTR seq + 25 auaaccaugugcaaagaugauggccaagcaagATGTCAGAGCAGACGCCGGCCGAGG
UTR dot + 25 …..(((.(….).))).(((((..((…..(((……))))).)))))…
RS 1 seq GGGUGUCCGCUGCAUGACGCAGCGCGGCAGGCUCAAGCGCUGGUCGGGCCGCCGCG
RS 1 dot ((….))(((((…..)))))(((((.(((((..((….)).)))))))))).
RS 2 seq GGGUGCCGCGCUCGUUGAGAGUGCAUGGCAGGUUAAUACGCUGGUCGGGCCGCCAACG
RS 2 dot …….((((((…..)))))).((((.((((…((….))..))))))))…
RS 3 seq CUUGGAUCCCGGUUUCAUCCCGGGUGGCUAUUCCGGCCGCCAAUCCGCCGGAGCGAC
RS 3 dot ……..((((…….))))((.((…((((((………)))))))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table