Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078081 Similarity: 0.961 Similarity: 0.960 Similarity: 0.960
UTR: 5HSAA078081
Gene: PDAP1
MFE: -67.370
ENS: 0.769
Length: 146.
Predicted Ligands:
cobalamin - 8/20
TPP - 6/20
FMN - 5/20
 RS: URS0002319766_32051
MFE: -43.549
Ligand: cobalamin
Species: Synechococcus sp. WH 7803 Cobalamin riboswitch
 RS: URS0000D93AEF_1965546
MFE: -40.308
Ligand: TPP
Species: Alistipes sp. An116 TPP riboswitch (THI element)
 RS: URS0000C66518_1736390
MFE: -61.516
Ligand: FMN
Species: Agromyces sp. Soil535 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078081 URS0002319766_32051 URS0000D93AEF_1965546 URS0000C66518_1736390
Length 146. 147. 145. 146.
Similarity - 0.961 0.960 0.960
Ensemble Norm 0.769 - - -
MFE -67.370 -43.549 -40.308 -61.516
Ligands - cobalamin TPP FMN
Gene PDAP1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.002 11.003 4.
Length SE - 1. 1. 0.
Lev Distance - 44. 47. 52.
UBS 11. 12. 13. 11.
BS 0. 0. 0. 0.
ILL 5. 3. 4. 4.
ILR 5. 4. 6. 4.
H 2. 2. 2. 1.
BL 2. 4. 1. 2.
BR 2. 4. 4. 3.
UN 0.027 0.068 0.083 0.027

Sequences

Field Description
UTR seq + 25 acugcggccacugaagcggcggcggcggcuggcccaggaggaagaagucgagcccaagcuauuuccgguuccggugucaguucgaggcgccgccgccgccgccgcagccgccggagccgcaATGCCTAAAGGAGGAAGAAAGGGAG
UTR dot + 25 .((.((((..(((..((((((((((((((((((((.((((…(((((..(((….))))))))…)))))).))))………))))))))))))))..)))..)))).))((……(((…..)))……))…
RS 1 seq AGGGUAAGUUGAUGUACUGGUUUCAGCGGGGAACAGCCGCUGAUGGAAACGGGGAAAGAACGGUGAAAAUCCGUCGCUGUCCCGCAGCUGUGAAACUUCGCCACGCGCGAAGUCAGUCAGAACGCCCGCCAGGCCAUGUCUCGACGA
RS 1 dot .((((..(((..((.(((((((((.((((((((((((.((.(((((..(((((…………….)))))..)))))..)).)))))……)).)).)))..))))))))))).)))))))…((((…))))……
RS 2 seq CCGACACAAGAGGGGUGCCUUCGGGAAAAACGGACGCCGCACGGGAUUCACACCGCCGGCGGGCAGGUUCCACGCAAAGGCUGAGAUCACACCCUAUGAACUUGAUGCGGGCAACACCGACGAAAGGACUUGUUCAUAGACCGUA
RS 2 dot (((.(((((((((((((((((((((((….(..(((((..(((……..))).)))))..)…)))).))..)))))…….)).))))…..)))).)))))((((..((…….))..))))…………
RS 3 seq AAACGUGCUCCGGGGUCGGUGUAAUUCCGAACCGGCGGUGACAGUCCGCGAGCUGCGAGCACGAGGCCGACAGGUCUCGGGCGAGCGGUUGAACCGGUGGAAUUCCGGUACCGACGGUGAAAGUCCGGAUGGGAGGCGGCACGUGU
RS 3 dot ..(((((((((((((((((((…..((((((((.((((..(((.((((..(((…….(((((((….))))))))))..))))))).)))).)))..))).)))))))))……..))))))………))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table