Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078273 Similarity: 0.949 Similarity: 0.946 Similarity: 0.946
UTR: 5HSAA078273
Gene: PDE4B
MFE: -59.848
ENS: 0.847
Length: 171.
Predicted Ligands:
glucosamine - 10/20
lysine - 5/20
methionine - 1/20
 RS: URS0000BF5631_1246476
MFE: -58.160
Ligand: methionine
Species: Arthrobacter crystallopoietes BAB-32 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000BE155B_33934
MFE: -59.606
Ligand: glucosamine
Species: Anoxybacillus flavithermus glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000D8B0AF_1903704
MFE: -56.168
Ligand: glucosamine
Species: Tumebacillus sp. AR23208 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078273 URS0000BF5631_1246476 URS0000BE155B_33934 URS0000D8B0AF_1903704
Length 171. 171. 171. 170.
Similarity - 0.949 0.946 0.946
Ensemble Norm 0.847 - - -
MFE -59.848 -58.160 -59.606 -56.168
Ligands - methionine glucosamine glucosamine
Gene PDE4B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.005 28.003 10.
Length SE - 0. 0. 1.
Lev Distance - 63. 60. 67.
UBS 9. 9. 10. 11.
BS 2. 3. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 1. 3. 1.
H 4. 5. 5. 4.
BL 3. 4. 2. 2.
BR 6. 3. 2. 6.
UN 0.158 0.228 0.099 0.147

Sequences

Field Description
UTR seq + 25 agagcgcugcggccgcggcggugcagcagaggcgccucgggcaggaggagggcggcuucugcgagggcagccugagguauuaaaaagugucagcaaacugcauugaauaacagacauccuaagaggggauauuuuccaccucuauaATGCCTGAGGCAAATTATTTGTTAT
UTR dot + 25 ….((((((….))))))((.(.(((((((((((((………)))).)).)))))))..).)).((((.((((((((….(((((…………………)))))….((((((((…..))).))))).)))))))).))))…………..
RS 1 seq CUUCACGAGAUGUGACCCGCAACACACCGGCAGCCUGUCGGUGUACAGCACGGCUCCGACCGGUCACGCACCAACCCCAUGUUCGCUGGGUGGUUCGGAUGACGAAGCGGCCUGCAUUUUCGCAGAACAACGAGGUUCUGAAAGGGGACUCGGUGCGGGCAAGAACAACUG
RS 1 dot ..((((…..))))…((…(((((((((…)))))))))…)).(((……)))(((.((((((..((((……((.((.((.((((…..)))).)).)).))…….((((((……))))))…))))….)))))))))………..
RS 2 seq GAUCGUAUAAAAGCGCCUGGACUAAGCUUUGGACGGGAAAAAGCUUAGUUGACGAGGAGGAGGUUUAUCGAGUGUUCGGCGGAUGCCUCCCGGCUGAUGCGAUGACAGCCGCAAGUUCUUUCUUAAAACAAAGAGGCGACUCUUUGCACAAAGGAAAGAGCGUUCAUCGUA
RS 2 dot …(((……)))(((.(((((((((((………))))))))))…).))).((((((((.((((….))))..)).))))))((((((………))))))…((((((((((….(((((((….)))))))…..))))))))))……….
RS 3 seq GUUUUUUCAAAAGCGCCUGAACUGGACGCACGGACGGAAACAGCGAUCCAGUUGACGAGGUGGAGGAGUAUCGAACAUCGGCGGAUGCCUCCCGGUGUAUAGCCGCACCGAAAGAGCGUUUUUCGAAAUCCGGCAGGUGACUGACGGGACAAGAGACGCUUUGGCUACAA
RS 3 dot ………….((((((((((((((((………….))).)))))))..).)))))..((((((((………..))))).)))((((((……))))))..(((((((((((.(…((((.(((….))).)))).).)))))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table