Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078298 Similarity: 0.970 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA078298
Gene: PDE6B
MFE: -40.706
ENS: 0.868
Length: 129.
Predicted Ligands:
cobalamin - 9/20
TPP - 6/20
SAM - 3/20
 RS: URS000232B85A_591159
MFE: -55.049
Ligand: cobalamin
Species: Streptomyces viridochromogenes DSM 40736 Cobalamin riboswitch
 RS: URS0002319E61_1736488
MFE: -43.619
Ligand: cobalamin
Species: Nocardioides sp. Root190 Cobalamin riboswitch
 RS: URS0002315771_1304903
MFE: -35.381
Ligand: cobalamin
Species: Alteromonadaceae bacterium Bs31 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078298 URS000232B85A_591159 URS0002319E61_1736488 URS0002315771_1304903
Length 129. 129. 130. 128.
Similarity - 0.970 0.970 0.969
Ensemble Norm 0.868 - - -
MFE -40.706 -55.049 -43.619 -35.381
Ligands - cobalamin cobalamin cobalamin
Gene PDE6B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.007 7.004 11.001
Length SE - 0. 1. 1.
Lev Distance - 40. 36. 35.
UBS 11. 11. 12. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 3.
ILR 4. 3. 6. 2.
H 4. 4. 4. 5.
BL 4. 4. 3. 2.
BR 2. 2. 1. 3.
UN 0.124 0.039 0.062 0.094

Sequences

Field Description
UTR seq + 25 gagagguggccgcagggcgccugacgcgcugggcauaaccuccgcagacccugaacaucuaccagaaccugaaccggcggcagcacgagcacgugauccaccugATGAGCCTCAGTGAGGAGCAGGCCC
UTR dot + 25 ..(((((.(((.(((.(((…..))).))))))…)))))..(((…(((………)))…)))….((.((…((((….))))..)).))…((..((((…))))..))…..
RS 1 seq ACGUGCGGGUACAGUAGGCGGGUCGUCAUCACCCGUACGGGGGGAAGCCGGUGCAAUUCCGGCGCUGACCCGCAACCGUGAACCGCCACCCAGGCGGUGAGCCGGAUCGCCGCGUACGGUUCGUGACCG
RS 1 dot .(((((((((…((.((((…)))))).)))))))))(.(((..(((((…….)))))…..))).)….((..((((((…..))))))..))(((.((((.((…..))..)))))))
RS 2 seq GUACGCUGCCCGGGUUACAACAACUUCACGUUCGCGGUGGGGGAAGCCGGUCUGAAUCCGGCGCUGACCCGCAACCGUAGGCCACCUCGGGGUGGCGAGCCGGAGCACCUGUCGCAGACGUCUUGACACA
RS 2 dot …((((((.((((((…..))))…))…))))))(((..((((((…….)))))..)..)))((..(.((..((((((….))))))..)).)..))…(((((.((….)))))))..
RS 3 seq AGUCCCAGCCCUGCUAUAGGUGCCCUUUGGCGUAAUUGGGAAGCUCGGUGAAAAUCCAGCGCUGCCCCCGCAACGGUAAACAAUGCUAAGCAUUGAAGCCCGAUACCUGCCGAUAGUAGUUCGUAGAU
RS 3 dot ..((((((…(((((.(((…))).)))))…)))))).(((.(((….))).)))..(((….)))..(((…((((((…))))))..)))(((…((((…..)))).)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table