Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078304 Similarity: 0.975 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA078304
Gene: PDE6H
MFE: -35.956
ENS: 0.922
Length: 109.
Predicted Ligands:
TPP - 15/20
Ni/Co - 3/20
SAM - 2/20
 RS: URS0000AB3353_106370
MFE: -38.862
Ligand: TPP
Species: Frankia sp. CcI3 TPP riboswitch (THI element)
 RS: URS0000D7F677_1906324
MFE: -34.698
Ligand: TPP
Species: Tessaracoccus sp. ZS01 TPP riboswitch (THI element)
 RS: URS0000D7B72D_683228
MFE: -46.910
Ligand: TPP
Species: Micromonospora sp. FXJ6.011 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078304 URS0000AB3353_106370 URS0000D7F677_1906324 URS0000D7B72D_683228
Length 109. 108. 109. 109.
Similarity - 0.975 0.973 0.972
Ensemble Norm 0.922 - - -
MFE -35.956 -38.862 -34.698 -46.910
Ligands - TPP TPP TPP
Gene PDE6H - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.006 8.002 7.008
Length SE - 1. 0. 0.
Lev Distance - 30. 34. 36.
UBS 6. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 1. 1. 2. 1.
H 2. 4. 3. 4.
BL 2. 1. 3. 2.
BR 2. 2. 1. 1.
UN 0.128 0.204 0.083 0.220

Sequences

Field Description
UTR seq + 25 aaagaaggcagcugggcagcugauaggaacaacauucagcuccgaggcugaaagggaaacaucagccgcccggggggaguuaaaATGAGTGACAACACTACTCTGCCTG
UTR dot + 25 …………..(((.((((((……….(((((((….)))))))……..)))))).)))((((.(((((…….((((….))))))))).))))
RS 1 seq GAAGUUGAUCGCGGGAGCUCCGCCAAGGGGCUGAGAGGGCGGCUGGGGCCGCCGACCGCAGGAACCUGUCCGGGUAAUGCCGGCGUAGGGAGUCUUACAUGGUGUCGC
RS 1 dot ……………((((((…..))))))…..((((((….))))))..((((((….)))..)))((.((((((..(((((….))))).)))))).))
RS 2 seq CAGACACCCCACGGGUGCCCGGGCACGGGCUGAGAUCAAGCUGAUGCCGCUUGCGACCGUCGAACCUGUCCGGGUCAUGCCGGCGAAGGAAGAGAGUCAGAUGGAAAUC
RS 2 dot ….(((((…)))))((((((((.((..(((…(((((…….)))))……)))..))))))))))((((.(.(((………..))).)))))…..
RS 3 seq CGACGAACCCACGGGAGCCCGGUGUACCGGGCUGAGAGGGGGGCUGCAGCCCCCGACCGUCGAACCUGAUCCGGGUAAUGCCGGCGCAGGGAGGAGUGUUGCCGUGCCG
RS 3 dot ……………(((((((….)))))))…..((((((….))))))….((…(((((…)))))…))((((((.((.((…..)).))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table