Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078322 Similarity: 0.983 Similarity: 0.983 Similarity: 0.980
UTR: 5HSAA078322
Gene: PDE9A
MFE: -33.316
ENS: 0.753
Length: 88.
Predicted Ligands:
glutamine - 7/20
zmp-ztp - 4/20
homocysteine - 3/20
 RS: URS0000BF7D36_388467
MFE: -20.501
Ligand: glutamine
Species: Planktothrix agardhii NIVA-CYA 126/8 Glutamine riboswitch
 RS: URS000211BA9F_1160
MFE: -20.501
Ligand: glutamine
Species: Planktothrix agardhii glnA
 RS: URS0000BF0D13_1173025
MFE: -17.851
Ligand: glutamine
Species: Geitlerinema sp. PCC 7407 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078322 URS0000BF7D36_388467 URS000211BA9F_1160 URS0000BF0D13_1173025
Length 88. 89. 89. 89.
Similarity - 0.983 0.983 0.980
Ensemble Norm 0.753 - - -
MFE -33.316 -20.501 -20.501 -17.851
Ligands - glutamine glutamine glutamine
Gene PDE9A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.021 4.021 8.021
Length SE - 1. 1. 1.
Lev Distance - 21. 21. 23.
UBS 6. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 0. 1. 1. 1.
H 3. 2. 2. 2.
BL 2. 2. 2. 1.
BR 1. 2. 2. 1.
UN 0.091 0.236 0.236 0.236

Sequences

Field Description
UTR seq + 25 ucccgcggcggcuggcgucgggaaaguacaguaaaaaguccgagugcagccgccgggcgcaggATGGACGCATTCAGAAGAGCATTCA
UTR dot + 25 ..((.((((((((.((((((((…………….))))).)))))))))))))….(((((….))))).(((…..))).
RS 1 seq AUCGUUCAUCUCUUGGUAGUCUUUGAUUCUCGCAUACCAAAAUGACUACUAAAAGACGGAAGUAGGGACUUCUCCCGAAGGAACGCGCC
RS 1 dot ….(((.(((.(((((((((((((…………))))..))))))))).))).)))….((((….))))………….
RS 2 seq AUCGUUCAUCUCUUGGUAGUCUUUGAUUCUCGCAUACCAAAAUGACUGCUAAAAGACGGAAGUAGGGACUUCUCCCGAAGGAACGCGCC
RS 2 dot ….(((.(((.(((((((((((((…………))))..))))))))).))).)))….((((….))))………….
RS 3 seq AUCGUUCAUCCCUUUAGAGAAAAUCCGUAAACCUAAGUCAGUUUCUCCGUAAGGGACGGAAGUAGGGAAUUACCCCGAAGGAACGCGCC
RS 3 dot ….(((.((((((..((((((……………….))))))…)))))).)))….(((……)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table