Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078536 Similarity: 0.972 Similarity: 0.967 Similarity: 0.967
UTR: 5HSAA078536
Gene: PDK2
MFE: -51.650
ENS: 0.985
Length: 129.
Predicted Ligands:
FMN - 8/20
TPP - 5/20
SAM - 3/20
 RS: URS0000C42A0E_742823
MFE: -41.749
Ligand: FMN
Species: Sutterella wadsworthensis 2_1_59BFAA FMN riboswitch (RFN element)
 RS: URS0000ABA836_743718
MFE: -45.
Ligand: FMN
Species: Isoptericola variabilis 225 FMN riboswitch (RFN element)
 RS: URS0000DA2914_1805218
MFE: -44.644
Ligand: TPP
Species: Hydrogenophilaceae bacterium CG1_02_62_390 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078536 URS0000C42A0E_742823 URS0000ABA836_743718 URS0000DA2914_1805218
Length 129. 130. 130. 129.
Similarity - 0.972 0.967 0.967
Ensemble Norm 0.985 - - -
MFE -51.650 -41.749 -45. -44.644
Ligands - FMN FMN TPP
Gene PDK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 2. 2.002
Length SE - 1. 1. 0.
Lev Distance - 36. 42. 44.
UBS 12. 12. 12. 12.
BS 0. 0. 0. 0.
ILL 5. 5. 4. 5.
ILR 5. 6. 4. 4.
H 1. 1. 1. 1.
BL 4. 4. 4. 5.
BR 5. 5. 5. 5.
UN 0.016 0.008 0. 0.062

Sequences

Field Description
UTR seq + 25 agggcaaggguagggaggaggcggccgaaccgcgucgcugggccgaaaggugcgcgagcgcugcccgcgcggggaccacaacccaagucgcggccgccgcagccATGAAAGAGATCAACCTGCTTCCCG
UTR dot + 25 .(((…(((((((((((..(((((….(((((.(..((((……(((.(.((.(((…..))).)).).)))….)))).).)))))..)))))..))……….))..)))))))))).
RS 1 seq UGCAAUCUUCAGGGCAGGGUGAAAGUCCCUACCGGCGGUACAGCCCGCGAGCGCCUCUCCCUCAGGGGAAGCGCAUGAUCAGGUGAAACUCCUGGGCCGACGGUCACAGUCCGGAUGUAAGAAGAUGCAG
RS 1 dot ((((.((((((((((…((((..(((….((((.(((…(((..((.((((.(((((….))))).)))).))….)))…))).))))…)))..)))).))))…)).))))…)))).
RS 2 seq UCGCGUGCUCUGGGGUCGGUGAAACUCCGAACCGGCGGUGAAAGUCCGCGACCCGGUCACAUCCAGUGCCCGGUUGACCAGGUGGAACUCCUGGACCGACGGUCAAAGUCCGGAUGGGAAGCGCACGCGA
RS 2 dot (((((((((((.(..((((….(((….((((.((((…(((((((((((.((.(((…..))))).))))……))))).))…..)))).))))…))))))).).)))…))))))))
RS 3 seq UUUUUUCGCUAGGGGUCUCCGCCCAAACCUUAUCCCCGCCUUGGCGCGUUUGGGGUCUAUUCGGAGUGAGAAACACCCUUGGAACCUGAUCCGGGCUGUACCGGCGUAGGGAAGCGAGGCCGCCGUGCC
RS 3 dot …….((..(((((((.(((…..((((((..(((….(((.((.(((((.((((…((.(((…..))))).)))).)))))..)).)))….))).))))))..)))))))).))..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table