Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078542 Similarity: 0.949 Similarity: 0.946 Similarity: 0.945
UTR: 5HSAA078542
Gene: PDK2_1
MFE: -76.397
ENS: 0.
Length: 186.
Predicted Ligands:
cobalamin - 19/20
FMN - 1/20

 RS: URS0002323A21_1449350
MFE: -60.715
Ligand: cobalamin
Species: Roseivivax halodurans JCM 10272 Cobalamin riboswitch
 RS: URS000232AFFA_1262781
MFE: -56.420
Ligand: cobalamin
Species: Clostridium sp. CAG:226 Cobalamin riboswitch
 RS: URS000073BC23_1795
MFE: -86.647
Ligand: cobalamin
Species: Mycolicibacterium neoaurum Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078542 URS0002323A21_1449350 URS000232AFFA_1262781 URS000073BC23_1795
Length 186. 185. 186. 187.
Similarity - 0.949 0.946 0.945
Ensemble Norm 0. - - -
MFE -76.397 -60.715 -56.420 -86.647
Ligands - cobalamin cobalamin cobalamin
Gene PDK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.004 12.010 23.001
Length SE - 1. 0. 1.
Lev Distance - 59. 65. 59.
UBS 17. 15. 19. 14.
BS 0. 0. 0. 0.
ILL 6. 5. 4. 3.
ILR 6. 7. 6. 5.
H 3. 3. 3. 3.
BL 6. 4. 8. 6.
BR 6. 4. 6. 4.
UN 0.005 0.070 0.108 0.043

Sequences

Field Description
UTR seq + 25 auuggcgacgucgaggcgccaugacgagccgauuggcugggcguuggaaugcccgccagggcaaggguagggaggaggcggccgaaccgcgucgcugggccgaaaggugcgcgagcgcugcccgcgcggggaccacaaccaaagucgcggccgccgcagccATGAAAGAGATCAACCTGCTTCCCG
UTR dot + 25 ((((((..(((((.(….).))))).))))))((((.((((((….))))))))))(((…(((((((((((..(((((….(((((.(..(((…….(((.(.((.(((…..))).)).).)))….)))..).)))))..)))))..))……….))..)))))))))).
RS 1 seq AUCAAGAUCACGUCCGAAGGUCCGUUUUUGGAGAAAUUGGGAAGCCGGUGAAAUUCCGGCGCUGCCCCCGCAACUGUAAGCGGCGAGCGCUCCUCCCCACGCCACUGAUCCCCGCGAGGGAUUGGGAAGGCCGAGGUGCGCAGCGACCCGCAAGCCAGGAGACCAGCCGGAGGACGGAGACGACC
RS 1 dot .((((..((…(((((((……)))))))))..))))…(((((…….))))).(((((.((((..(((…((((((.((((.((((…..(((.((((((((…..))))))))…))).)))).))))..))..))))….)))..)……))).)).)))……..
RS 2 seq AAGAAUAAACAGGUUCCAUGUUCCGCCCGAAGGUGGGCGGCUAAGAGGGAAGACGGGUGAGAUCCCCGCACGGACGCGCCGCUGUAAAGGACGAGUCGGCCGCAAAAUGCCACUGAAGCGAUUUGGGAAGGCGCGGCAGACAUAUACGGCCUGAGUCAGAAGACCUGCACGGAAUGGGCUUCGCCA
RS 2 dot ………….((((.(.(((((((((….)))))))..)).).))))..((((.(….)))))..((((.((.(((((((..(((.(((.(((((((….(((…(((..(((.(((….))))))..))).)))…))))).)).))….).)))..))))..)))))))))…
RS 3 seq UGCUAGCCUGUGCGGGCCAGUCACCUCCGCAGGGAGUAGGGAACCCGGUGUGAAUCCGGGACUGACGCGCAGCGGUGAGGGGAUGACGAGGCGGGCCACGUGCCACUGGGAGCGCAUGCUCCCGGGAAGGCGGCCCGCCGAGGACGACCCCCGAGUCCGAAUACCUGCUGGCAUCCGCGACGGUGUG
RS 3 dot ((((..((((((.(((…….))).)))))).))))…..(((((…….)))))((((.((((((((((((.((((.((.(..((((((((….(((.((((((((….))))))))…)))))))))))..)..)).))))))………..))))))…..)))).))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table