Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078653 Similarity: 0.967 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA078653
Gene: PDP2
MFE: -46.090
ENS: 0.784
Length: 146.
Predicted Ligands:
cobalamin - 12/20
Mn2+ - 2/20
FMN - 2/20
 RS: URS00023290F2_876044
MFE: -47.757
Ligand: cobalamin
Species: gamma proteobacterium IMCC3088 Cobalamin riboswitch
 RS: URS000232C988_489825
MFE: -44.163
Ligand: cobalamin
Species: Lyngbya majuscula 3L Cobalamin riboswitch
 RS: URS000231F1A2_197221
MFE: -51.873
Ligand: cobalamin
Species: Thermosynechococcus elongatus BP-1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078653 URS00023290F2_876044 URS000232C988_489825 URS000231F1A2_197221
Length 146. 146. 144. 145.
Similarity - 0.967 0.964 0.964
Ensemble Norm 0.784 - - -
MFE -46.090 -47.757 -44.163 -51.873
Ligands - cobalamin cobalamin cobalamin
Gene PDP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.002 4.001 12.
Length SE - 0. 4. 1.
Lev Distance - 41. 41. 42.
UBS 9. 10. 10. 8.
BS 0. 0. 0. 2.
ILL 1. 3. 1. 1.
ILR 0. 1. 1. 2.
H 4. 4. 5. 3.
BL 3. 1. 2. 2.
BR 4. 4. 4. 3.
UN 0.130 0.082 0.153 0.138

Sequences

Field Description
UTR seq + 25 cggacggagcgggcggcuguggccucgccagcuggugagaagcgggcgaggguccgagguagggaagguuuaaaaauauccuuuuuugcugaaggaacacauuugcugguauaguuucagaATGTCAAGTACTGTGTCCTACTGGA
UTR dot + 25 ….((.(((…..))).)).(((((((.(((…….))).)))))))……(((((((((((………..)))))))))))..(((.(((((..(((((((((………)))))).))).))))))))……
RS 1 seq UACUCUGACCGCGUUCUUGGUGCCUGCCGCCCUCUCGCGGGCUGGGUAGGUUAAAAGGGAAGUCUGGUAAGAAAUCCAGCGCUGCCCCCGCAACGGUAAUCAGCCCCUGCUGUAAGCCCGAUACCUGCCGGAACAGCAACCGAUGG
RS 1 dot …….((((……))))(((((((((((……))))..)))))))…..(((.(((((((……..)))).))).)))(((…((((……….((((((….(((……..))).)))))))))).)))
RS 2 seq ACUACCUGAAGUUCCAUCGGUUCUGGUGAAGAGCACUCACCAGAGGUAACGGGGAAAGUCCGGUGCAAGUCCGGCGCUGUCCCGCAGCUGUGAUGAGGUCUGUCACCUCUUAGUCAGAAUGCCCGCCAAUGGUGUCAGUUGUUG
RS 2 dot …..((((…….))))(((((((((…….)))))))))……((((.(((((((…….)))).))).))))(((..(.(((((((((…..)))))…)))).).))).((((…))))……….
RS 3 seq UGGUUGGCUUAGUUGCUCGGUUCUGGUGGGGAUCAGCCAUCAGACGUAAGGGGGAAAGUGCAGUGUGAAUCUGCCGCUGUCCCGCAGCUGUGAGGAGAGAUCUCACUCUCUAAGUCAGAAUGCCCGCCGAGUGGUCAACCCGAUA
RS 3 dot .((((((((…..(((((((((((((((…….))))))))…….((((.(((((((…….)))).))).))))(((.((((..((((((……))))))..).)))..)))..)))))))))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table