Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078669 Similarity: 0.970 Similarity: 0.967 Similarity: 0.965
UTR: 5HSAA078669
Gene: PDRG1
MFE: -58.557
ENS: 0.879
Length: 144.
Predicted Ligands:
molybdenum - 12/20
cobalamin - 6/20
TPP - 2/20
RS: URS0000AB498F_264732
MFE: -56.699
Ligand: molybdenum
Species: Moorella thermoacetica ATCC 39073 Moco (molybdenum cofactor) riboswitch
RS: URS0000C5D39A_1217799
MFE: -48.686
Ligand: molybdenum
Species: Dehalogenimonas alkenigignens Moco (molybdenum cofactor) riboswitch
RS: URS0000C3F825_768710
MFE: -45.791
Ligand: molybdenum
Species: Desulfosporosinus youngiae DSM 17734 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078669 URS0000AB498F_264732 URS0000C5D39A_1217799 URS0000C3F825_768710
Length 144. 142. 145. 142.
Similarity - 0.970 0.967 0.965
Ensemble Norm 0.879 - - -
MFE -58.557 -56.699 -48.686 -45.791
Ligands - molybdenum molybdenum molybdenum
Gene PDRG1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 6. 8.002
Length SE - 4. 1. 4.
Lev Distance - 33. 40. 38.
UBS 11. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 1.
ILR 2. 2. 2. 2.
H 4. 4. 4. 5.
BL 5. 3. 3. 3.
BR 3. 3. 4. 2.
UN 0.132 0.148 0.138 0.085

Sequences

Field Description
UTR seq + 25 accguucuuuuaacugcgcaggcgcgccggaagcaccuagagagcggcgcgugcgcagcgggagucgaagcggagaucccggggucgcgcgagagccgcaagcggaguuggugggcgcuATGCTATCACCCGAGGCAGAGCGAG
UTR dot + 25 ………….((((((..((((((((……………))))))))))))))(((((.((……))..)))))….(.(((.((..(((….)))..)).))).)((((.((((.((….)))))).))))..
RS 1 seq AACUCUAUAAACCUCCGAGCCAGUGGGCCUAAGGUUUUCGGCUAUGGCUGCUGGCCUCCUGCCUGCUUGCCAGGCAGCGACGGGGUAGGCGGGGAAACCGGCCUGCCUCCCGGAAUGGGAAAGGAGUAUUUGACCCGGUGGU
RS 1 dot …………….((((((((.((((..((……..))..)))))))))).))(((((((…..)))))))….(((((((((.((….)).)))))))))(((…((((.(((…..)))..)))).))).
RS 2 seq UUAAAUAUUGAUCUCCGAAGUCUUGGAGCCUAACUCCUCGGUGAUAUGGCGACAAGACCGGCGGUCCUUCACAGAAGGACCCGAGGGUGAUGCCGGAAACGGCGCCGCCUCCCGCGAUUUGGAAAGGAGAGCAUGCCAUGACGAG
RS 2 dot …………..(((..((((((..(((……………..)))..))))))))).((((((((…))))))))((.(((((.(((((….))))).)))).).))….(((..(.((……..)).)..))).
RS 3 seq AUAAUAGGUCUUUUCCGUGUUCUGACAGCUAAAAGGAUAACUCAUGCUGUCAGAACCUGAGUCUGAACUUUACGGGCUCACGGGGUUAUGAUUGGAAACGGUCUAACCUUCACUUUUGAGAAGGAAAAGCUGCGGCAGAAGA
RS 3 dot ……((……))..(((((((((((….((…..))…)))))))))))(((((((((…….)))))))).)((((((.(((((….)))))))))))…((((((.(.((……)).)..)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table