Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078671 Similarity: 0.969 Similarity: 0.967 Similarity: 0.966
UTR: 5HSAA078671
Gene: PDRG1_0
MFE: -58.557
ENS: 0.883
Length: 147.
Predicted Ligands:
molybdenum - 14/20
cobalamin - 3/20
FMN - 2/20
 RS: URS0000D957FE_1803461
MFE: -58.078
Ligand: molybdenum
Species: Acidobacteria bacterium 13_2_20CM_2_57_6 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C20BED_1095749
MFE: -31.201
Ligand: molybdenum
Species: Pasteurella bettyae CCUG 2042 Moco (molybdenum cofactor) riboswitch
 RS: URS0000D78834_1797613
MFE: -65.388
Ligand: molybdenum
Species: Chloroflexi bacterium GWB2_54_36 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078671 URS0000D957FE_1803461 URS0000C20BED_1095749 URS0000D78834_1797613
Length 147. 147. 146. 148.
Similarity - 0.969 0.967 0.966
Ensemble Norm 0.883 - - -
MFE -58.557 -58.078 -31.201 -65.388
Ligands - molybdenum molybdenum molybdenum
Gene PDRG1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 15.001 10.
Length SE - 0. 1. 1.
Lev Distance - 39. 36. 40.
UBS 11. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 2.
ILR 2. 1. 2. 2.
H 4. 4. 4. 5.
BL 5. 4. 2. 3.
BR 3. 4. 1. 1.
UN 0.150 0.197 0.185 0.155

Sequences

Field Description
UTR seq + 25 accaccguucuuuuaacugcgcaggcgcgccggaagcaccuagagagcggcgcgugcgcagcgggagucgaagcggagaucccggggucgcgcgagagccgcaagcggaguuggugggcgcuATGCTATCACCCGAGGCAGAGCGAG
UTR dot + 25 …………….((((((..((((((((……………))))))))))))))(((((.((……))..)))))….(.(((.((..(((….)))..)).))).)((((.((((.((….)))))).))))..
RS 1 seq CUAGGCCUGUAACUCCGACCCCGGAAGCCUACGGGAGAGAUAACCCAUGGCUACCGGGGCGAUGCCCCGAGAAAUCGUCGGGGCUGAGGGUUUGAGCGGAAACGCCCGGGCCUCCCAUGUUUGGAAAGGAGCGAUGAAACCGAAAAU
RS 1 dot ……………((.((((((.((((…(((……..)))..)))).))))))))..(((((((…….))))))).(.(((((((.(((….))).))))))).)(((((((……)))).)))………..
RS 2 seq AAAUUUUGAUUAUACCGAGCUUGUUUACCUACAUUUUUUAGAAAAUAGGGUAGCAAUGCCAGCAACAGCAGUUCAUGUUGCUCAGGGAUAAGAUUGGAAACGAUUUAUCCUCUCAUUUUUAGUAAAGGUAUUAAAUGAACACGAUU
RS 2 dot …………….(.(((((((..((((..(((….)))..))))..))))).)))(((((((……..)))))))..(((((.((((((….))))))))))).((((..((((((….))))))))))……..
RS 3 seq CUUCUCAUUCUUCUCCGAGUCUGGCUGCCUGCCGGCGAAUGCUAACGGCAGCCAGGCCGGCCGCUAGAGCAAGCGGCCCCGGUUGGACCGGAAACGGACCAGCCCCCCGACCGUAAGGUCAUUGGAAAGGAGACACCCCUGGCUGAUC
RS 3 dot …………….(.(((((((((((.(..(((….)))..)))))))))))))(((((((……)))))))..((((((.(((….))).))))))….((((….))))(((((..(((…….)))..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table