Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078674 Similarity: 0.935 Similarity: 0.934 Similarity: 0.931
UTR: 5HSAA078674
Gene: PDS5A
MFE: -98.299
ENS: 0.870
Length: 221.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS000231C504_1352941
MFE: -102.502
Ligand: cobalamin
Species: Streptomyces niveus NCIMB 11891 Cobalamin riboswitch
 RS: URS0002330FB7_1450761
MFE: -56.596
Ligand: cobalamin
Species: Aneurinibacillus sp. XH2 Cobalamin riboswitch
 RS: URS000231E6B4_714995
MFE: -62.983
Ligand: cobalamin
Species: Gluconacetobacter hansenii ATCC 23769 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078674 URS000231C504_1352941 URS0002330FB7_1450761 URS000231E6B4_714995
Length 221. 221. 220. 219.
Similarity - 0.935 0.934 0.931
Ensemble Norm 0.870 - - -
MFE -98.299 -102.502 -56.596 -62.983
Ligands - cobalamin cobalamin cobalamin
Gene PDS5A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 5.005 7.001
Length SE - 0. 1. 4.
Lev Distance - 85. 85. 82.
UBS 17. 18. 16. 17.
BS 0. 0. 0. 0.
ILL 7. 9. 8. 5.
ILR 7. 7. 6. 7.
H 3. 3. 2. 4.
BL 5. 5. 5. 6.
BR 3. 3. 4. 4.
UN 0.018 0.005 0.091 0.050

Sequences

Field Description
UTR seq + 25 ccggcucccggggcacggacggccgggcgcgcgccucugcgaggggcguccggguccgagucggcgguccgggccggcgcgaggugcgugcgggcgggccgcgggggucccggacggacacaagcgcacacacucccggaagaucgcuuacccuccggggguaaaagagaucaccgacaagaucaccacggacgagATGGACTTCACCGCGCAGCCCAAGC
UTR dot + 25 ((((((.(((…..)))..))))))(((((((((((.(((..((…((((((.(((……)))))))))))..))))))))))))))((((..(.(((((((((((….((..(……………..(((..((((.((((((((…))))))..)).)))).)))………….)..))….))))))..)))))).))))….
RS 1 seq AGGCUGUUGAGUGCAGCUGGUUCGUUCCUGUCCGCCAGGCAGGACGUCGUAAGAGGGAACCCGGUGGGAAUCCGGGACUGCCCCGCAGCGGUGAGUGGGAACGACCGCCGUCAUACGCACUGGGCCCGGCCGGGUCUGGGAAGCGACGGCCAGUAGGUGUCUCGUGGCCGACACGAGACGGGCCCGCGAGUCCGAAGACCUGCCCGUUGCCCGUGCGCGAC
RS 1 dot .((((((…..))))))((((((((((((..((((..((..(.((……..(((..(((((…….)))))….)))))).))))))..)))))))))..)))(((…(((((.((((.(((.(((((((.(((..((..((((……(((((((((…..)))))))))))))..))..)))..))))))).)))..))))))))).)))
RS 2 seq AAUAUAGGUAAGCUUUAUGGUGUGUUUGCAUGAUUUUUUAUCUUACUAAGAGAUCAGGUAAACACUUAAAAGGGAAGACCGGUGAAAGUCCGGCGCGGUCCCGCCACUGUGAACGGGGAGCAACUCUUGGAUUCACCACUGUUUCAUAAGACUGAAAUGGGAAGGUAUAGAGAAGCGAUGAUCCGUAAGCCAGGAGACCUGCCAUAAAGAAAGCACCGUU
RS 2 dot …………((((.(((.((((((((.((((((((((……)))))))))).))))))))))).))))……(((((…….((((.((((…((…((..(((((..((..((((((..(((.(((…(((((……)))))))))))..)).))))..))…..)))))..))..)).))))))))……….)))))..
RS 3 seq GAUCAGAACAGGUGCGACGGUUCCUUCUGCCGGAGGGAUUAAAAGGGAACGAAGUGCGGAAUUACCAUCCAAUGCUUCGGCUGUCCCCGCAACUGUAAGCGGUAUGUCUUUGCAUUACCGGAUGUAACGGUCCGGGCCACUGAAAACCACGGUUUUCGGGAAGGUUAUGCAUGAUGCCAAGCCGCAAGCCAGGAGACCUGCCGUCCUUAGUGGUUGCGA
RS 3 dot …((((..(((.((….)).)))))))((….))…….((((.((((((..(((…….)))…))))))….))))(((((((.(((((((((.((((((((((((…(.((((((..(((.((..((((…….))))..)).)))..))))))).))))))…………..)))))).)))))..))))..))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table