Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078841 Similarity: 0.984 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA078841
Gene: PEMT
MFE: -23.455
ENS: 0.793
Length: 92.
Predicted Ligands:
TPP - 8/20
glycine - 5/20
cobalamin - 2/20
 RS: URS0000AB2144_457429
MFE: -36.719
Ligand: cobalamin
Species: Streptomyces pristinaespiralis ATCC 25486 Cobalamin riboswitch
 RS: URS00007D0A74_511145
MFE: -30.055
Ligand: Mg2+
Species: Escherichia coli str. K-12 substr. MG1655 small RNA SroA
 RS: URS0000C1769C_1423804
MFE: -16.776
Ligand: SAM
Species: Lactobacillus similis DSM 23365 = JCM 2765 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078841 URS0000AB2144_457429 URS00007D0A74_511145 URS0000C1769C_1423804
Length 92. 93. 93. 90.
Similarity - 0.984 0.980 0.979
Ensemble Norm 0.793 - - -
MFE -23.455 -36.719 -30.055 -16.776
Ligands - cobalamin Mg2+ SAM
Gene PEMT - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.002 10.004 10.005
Length SE - 1. 1. 4.
Lev Distance - 16. 23. 20.
UBS 5. 8. 7. 6.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 3. 3. 1. 1.
H 2. 2. 2. 2.
BL 1. 2. 2. 1.
BR 0. 2. 1. 2.
UN 0.065 0.108 0.129 0.133

Sequences

Field Description
UTR seq + 25 ggcgaggagaggcacaccacuauuguuuuaauuugcuuuuaccugauuccuggcagacuucugcguuATGAAGAGATCTGGGAACCCGGGAG
UTR dot + 25 ((((((..((((((………))))))..))))))….((((.(((((((….((((……..))))….)))))))..))))..
RS 1 seq GAGGAAGCCCGGUGAGAUUCCGGCGCGGUCCCGCCACUGUGAGCCCGGCAGCAGCGCCGCACACGCGCACACCGCCGGGUGAGCCAGGAACUC
RS 1 dot (.(((.((((((…….)))).))..))))….((((..(((((((….((((…….))))…..)))))))..).)))……
RS 2 seq GUUCUCAACGGGGUGCCACGCGUACGCGUGCGCUGAGAAAAUACCCGUCGAACCUGAUCCGGAUAACGCCGGCGAAGGGAUUUGAGGCUCCUU
RS 2 dot .(((((…..((((.(((((….))))))))))))))…..((.((((((((…((((……))))….))).)))))))……
RS 3 seq UAAAGUUAUGAGUCUUCAUUCCCGAUAGGAUUCACUAGCUCUAGUGAAGAUGCCUUGUAACCGAAAAACGAAUUGGGGGAAUUUUUUAUG
RS 3 dot …((((((((((((((……))..))))))).)))))…..((((((.(((…..((((……..))))))).))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table