Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078930 Similarity: 0.978 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA078930
Gene: PEX1
MFE: -55.748
ENS: 0.958
Length: 121.
Predicted Ligands:
SAM - 18/20
glycine - 1/20
cobalamin - 1/20
 RS: URS0000D96F94_1801977
MFE: -42.606
Ligand: SAM
Species: Planctomycetes bacterium RIFCSPHIGHO2_12_39_6 SAM riboswitch (S box leader)
 RS: URS0000D7C71C_1792845
MFE: -35.452
Ligand: SAM
Species: Mucilaginibacter pedocola SAM riboswitch (S box leader)
 RS: URS0000C73599_1763534
MFE: -20.756
Ligand: SAM
Species: Flavobacterium crassostreae SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078930 URS0000D96F94_1801977 URS0000D7C71C_1792845 URS0000C73599_1763534
Length 121. 123. 120. 121.
Similarity - 0.978 0.977 0.977
Ensemble Norm 0.958 - - -
MFE -55.748 -42.606 -35.452 -20.756
Ligands - SAM SAM SAM
Gene PEX1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 3.005 8.002
Length SE - 4. 1. 0.
Lev Distance - 24. 28. 28.
UBS 8. 8. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 2. 2. 2. 3.
H 3. 3. 3. 3.
BL 4. 3. 4. 5.
BR 2. 2. 3. 3.
UN 0.132 0.130 0. 0.182

Sequences

Field Description
UTR seq + 25 cgaucgaucuccuccggcuccgacguccucggccugccgggucccggguccuuugcggcgcuagggugggcgaacccagagcgacgcuccgggacgATGTGGGGCAGCGATCGCCTGGCGG
UTR dot + 25 ………….(((((.((((…..))))…)))))((((((((……(((.((((.((((……))))..)))).)))))))))))..(((.((((…….)))).))).
RS 1 seq GUCUUAUCAAGAGUGGCAGAGGGACUGGCCCUAUGAAGCCACAGCAACCGGUCUUGUCCAGCGUAUGUGCUGAACAGGAUGCUGGUGCUAAUUCCUGUCUCUGUUGUUGGGAAGAGAUAAGAU
RS 1 dot …………(((((..((((…..))))…..)))))(((.(((((((((((.((((……)))).)))))..)))))))))…((.(((((((……….))))))).)).
RS 2 seq UACUUAUCCAGAAAGACAGAGGGAAAGGCCCUAUGAUGUCUUAGCAACCUGUACCGGCCACCUGGCUGUGUGUAAGGUGCUAAUUCCUGCUUCGUGAACCAACCCGGAGACAGAUAAGCU
RS 2 dot …………..((((.((((…..))))….))))(((((.((((.((((((((….))))).)))..)))))))))…((((((((.(……).))))).)))…….
RS 3 seq AUGUUAUAAAGAAAGGACGAGGGAAUAGACCCGUUGAAGCCUUAGCAACCCUUGGAUUAAUGGUAUUUAUUUAUUCAUGAAGGUGCUACAUUCUACCAUAAUUUAAAUGGGAAGAUAACAA
RS 3 dot ………….(((.((((((……))).)))…)))((((.((((.(((((.((((…..)))).))))).)..)))))))…(((.((((…….))))..)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table