Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078943 Similarity: 0.974 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA078943
Gene: PEX11A
MFE: -40.928
ENS: 0.808
Length: 120.
Predicted Ligands:
SAM - 16/20
molybdenum - 2/20
glycine - 1/20
 RS: URS0000C7C6F1_1385510
MFE: -37.391
Ligand: SAM
Species: Pontibacillus halophilus JSM 076056 = DSM 19796 SAM riboswitch (S box leader)
 RS: URS0000C68B85_1221500
MFE: -32.979
Ligand: SAM
Species: Fictibacillus phosphorivorans SAM riboswitch (S box leader)
 RS: URS0000C7C909_1508404
MFE: -40.926
Ligand: SAM
Species: Jeotgalibacillus malaysiensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078943 URS0000C7C6F1_1385510 URS0000C68B85_1221500 URS0000C7C909_1508404
Length 120. 120. 120. 120.
Similarity - 0.974 0.974 0.973
Ensemble Norm 0.808 - - -
MFE -40.928 -37.391 -32.979 -40.926
Ligands - SAM SAM SAM
Gene PEX11A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 1.001 5.001
Length SE - 0. 0. 0.
Lev Distance - 34. 35. 34.
UBS 10. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 2. 3. 2.
H 4. 4. 4. 4.
BL 4. 4. 4. 2.
BR 2. 3. 2. 3.
UN 0.117 0.075 0.083 0.083

Sequences

Field Description
UTR seq + 25 gauaaccugggacugaccguucccuggggauccgacgggccccagaggacccacgccugagccccgugcgacucguggccuuugggcuagaagccATGGACGCCTTCACCCGCTTCACCA
UTR dot + 25 ……..(((((…..)))))((((((.(((…))))))))).((.((((.(((((((.(……).)))).)))…)))))).(((((..((((….))))…)))))….
RS 1 seq UUCUUAUCCAGAGAGGUGGAGGGACUGGCCCUUUGAAGCCCGGCAACCAUCGAUUGUACAUGAUGUACAAUGUGAACGGUGCCAAAUCCUGCAAGAUUGAAGAAUCUUGGGAGAUGAGAG
RS 1 dot .((((…..))))(((((((((…..))))))…))).(((.(((.(((((((((((…)))))))).)))..))))))..(((.(.(((((((….))))))).).)))…..
RS 2 seq CUCUUAUUAAGAGCAGGUGGAGGGACUAGCCCGAUGAAACCCGGCAACCAUUCAGUUAAUUUUGCUUAACUGAAAACGGUGCUAAUUCUUGCAGUCGAACGUUUGGCUGAGAGAUAAGAG
RS 2 dot (((((…)))))(.((((..(((…..)))..)…))).)((.(((.(((((((((……)))))))))…)))))….((((.(((((((….))))))).))))……
RS 3 seq CUCUUAUCGAGAGUUGGCUGAGGGAAUUGGCCCUAUGAAGCCCGGCAACCGGCCCGCUGUAUACAUUCAGCAGGGACACGGUGCUACAUCCAACAGACGUAAUGGUCUGAGAGAUAAGAG
RS 3 dot (((((…)))))..((((.((((……))))….)))).(((.((((((((((((……..)))).))).).)))))))..(((…(((((……)))))…)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table