Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078949 Similarity: 0.980 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA078949
Gene: PEX11B
MFE: -38.267
ENS: 0.959
Length: 109.
Predicted Ligands:
TPP - 10/20
SAM - 7/20
GMP - 2/20
 RS: URS0000C69F1C_1715693
MFE: -34.117
Ligand: TPP
Species: Phaeobacter sp. CECT 7735 TPP riboswitch (THI element)
 RS: URS0000C0A16E_86668
MFE: -25.844
Ligand: TPP
Species: Bacillus niacini TPP riboswitch (THI element)
 RS: URS0000D7F677_1906324
MFE: -34.698
Ligand: TPP
Species: Tessaracoccus sp. ZS01 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078949 URS0000C69F1C_1715693 URS0000C0A16E_86668 URS0000D7F677_1906324
Length 109. 110. 108. 109.
Similarity - 0.980 0.976 0.976
Ensemble Norm 0.959 - - -
MFE -38.267 -34.117 -25.844 -34.698
Ligands - TPP TPP TPP
Gene PEX11B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 2.004 6.
Length SE - 1. 1. 0.
Lev Distance - 25. 30. 30.
UBS 8. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 1. 2. 2.
H 3. 3. 3. 3.
BL 2. 3. 3. 3.
BR 3. 3. 3. 1.
UN 0.083 0.136 0.148 0.083

Sequences

Field Description
UTR seq + 25 aacuccggcuacgggggcccgaacggaccgugaggcgcagauuugagccgcuguugagaugauuccuuuccguucgcggaagagATGGACGCCTGGGTCCGCTTCAGTG
UTR dot + 25 ..(((((….))))).((((((((((….((((…..((((.(((….))).))))….)))))))))))).))..(((.(((((……))))).)))….
RS 1 seq GCGCCUACCUCGGGGUGCCGGUACACAGUGUGCGGGCUGAGAUGCGCGAAUGCGAACCCGUUGAACCUGAACCGGUUAAGACCGGCGGAGGGAAGGUCCGUGGAAUGCUC
RS 1 dot .(((((……)))))(((((…(((.(((((((……(.(((….))).))))))…))))).)))))…….(.(((((…….))))).)…….
RS 2 seq UACUAGCACUGGGGGAGCCGGAAUUGGCUGAGAUUAGACUUGUAGUGGUCUUAAACCCCUGAACCUGAUCUGGGUUAUACCAGCGUAGGGAAGUGAACGAUCCAAUGC
RS 2 dot ……..((((…..))))…(((((.(((((((…..(((.(((…..))).)))…))))))).)))))…..((((.(((..(….)..))).))))
RS 3 seq CAGACACCCCACGGGUGCCCGGGCACGGGCUGAGAUCAAGCUGAUGCCGCUUGCGACCGUCGAACCUGUCCGGGUCAUGCCGGCGAAGGAAGAGAGUCAGAUGGAAAUC
RS 3 dot ….(((((…)))))((((((((.((..(((…(((((…….)))))……)))..))))))))))((((.(.(((………..))).)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table