Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA078966 Similarity: 0.991 Similarity: 0.991 Similarity: 0.988
UTR: 5HSAA078966
Gene: PEX19
MFE: -16.229
ENS: 0.805
Length: 52.
Predicted Ligands:
glutamine - 10/20
unknown - 8/20
fluoride - 2/20
 RS: URS0000D6CDD7_983917
MFE: -25.445
Ligand: unknown
Species: Rubrivivax gelatinosus IL144 nhaA-I RNA
 RS: URS0000E60938_121719
MFE: -17.231
Ligand: unknown
Species: Pannonibacter phragmitetus sul1 RNA
 RS: URS0000E6035A_401562
MFE: -19.262
Ligand: unknown
Species: Aurantimonas ureilytica sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA078966 URS0000D6CDD7_983917 URS0000E60938_121719 URS0000E6035A_401562
Length 52. 52. 53. 53.
Similarity - 0.991 0.991 0.988
Ensemble Norm 0.805 - - -
MFE -16.229 -25.445 -17.231 -19.262
Ligands - unknown unknown unknown
Gene PEX19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 4.003 3.
Length SE - 0. 1. 1.
Lev Distance - 11. 10. 14.
UBS 4. 5. 4. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 2.
ILR 1. 1. 1. 1.
H 1. 1. 1. 1.
BL 2. 2. 2. 2.
BR 2. 2. 0. 1.
UN 0.077 0.115 0.132 0.057

Sequences

Field Description
UTR seq + 25 cuccuacggcaagucggagguagcaagATGGCCGCCGCTGAGGAAGGCTGTA
UTR dot + 25 ….((((((…((((.(((.((……)).))).))))…..))))))
RS 1 seq GGGUGCCGUGGCGACCGCCGCGGCAGGUUCAUGCGCAGGUCGGGCCGCCGCG
RS 1 dot ……(((((((.(((((((.(((……))))).)).)))..)))))))
RS 2 seq GCAGGACUCGUUUGAUCGAGUGGCUAUCCCGAGCGCCGAUCCCUCGGGUUAAC
RS 2 dot ….((((((…(((((.((.(((……))))))))))…))))))…
RS 3 seq UUUGGACCCGUUCGAUCGGGUGGCUACGCUGGGCGCCGAUCCCCCGGCCAACU
RS 3 dot .((((..(((…((((.((((.(((…))).))))))))…)))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table