Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA079016 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA079016
Gene: PFDN2
MFE: -45.965
ENS: 0.842
Length: 103.
Predicted Ligands:
TPP - 8/20
glycine - 4/20
SAM - 3/20
 RS: URS00001CC526_317655
MFE: -37.658
Ligand: glycine
Species: Sphingopyxis alaskensis RB2256 gcvT element as predicted by Rfam
 RS: URS0000AB5938_28026
MFE: -27.455
Ligand: TPP
Species: Bifidobacterium pseudocatenulatum TPP riboswitch (THI element)
 RS: URS0000DAC453_642780
MFE: -38.925
Ligand: glycine
Species: Marmoricola sp. Sco-D01 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA079016 URS00001CC526_317655 URS0000AB5938_28026 URS0000DAC453_642780
Length 103. 102. 103. 104.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.842 - - -
MFE -45.965 -37.658 -27.455 -38.925
Ligands - glycine TPP glycine
Gene PFDN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 4.002 5.
Length SE - 1. 0. 1.
Lev Distance - 29. 32. 31.
UBS 9. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 1.
ILR 1. 1. 0. 1.
H 4. 4. 4. 4.
BL 2. 3. 2. 2.
BR 3. 3. 2. 4.
UN 0.087 0.059 0.039 0.087

Sequences

Field Description
UTR seq + 25 gggcgguaacucgcaggccggacgugacgcaaggcgggggcugagcugcgccggccggaaacccagcaggcggcgaagATGGCGGAGAACAGCGGTCGCGCCG
UTR dot + 25 ..((((….)))).((((((.(((…((..(((….)))..)).)))))))))……((….))(((((..(((.((……..)).))).)))))
RS 1 seq ACACUCUGGAAAGCGUUCCGGCGGGUUGUCGGAACCACCGAAGGGGUAACUCCGUCAACCGAUGGAGGAAAACUCUCAGGUUCCCGUGACAGAGGGGGCAUG
RS 1 dot …(.((((((….)))))).)(((((.((((…(((…..)))…)))).)))))…((((…..))))((.((((((……..)))))).))
RS 2 seq AAGCGCAGACACGGGGGCCGUAUGGCUGAGAGGAAGCAAGCGCUUCAACCGUAUGAACGUAUACCGGGUAAUGCCGGCGCACGGACGUCUCUCUUUUCCCGUG
RS 2 dot ..((.(……..).))(((((((.(((…..(((….)))))).)))))))..((….((((……))))))(((((…………..)))))
RS 3 seq AAACUCCGUGCGGGAGAGCUCCCGGCUGGUGCGUGCACCGACCGGGACGCCGAAGGGGCAUUUCCUCCCACCAACCUCUCAGGCCACAGGACCGCACGGGCUGG
RS 3 dot …((((…..)))).((((((((.(((((….))))).)))))).))….((((…….)))).(((.(((….((((…)).))….))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table