Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA079606 Similarity: 0.964 Similarity: 0.962 Similarity: 0.959
UTR: 5HSAA079606
Gene: PHF19
MFE: -39.256
ENS: 0.773
Length: 149.
Predicted Ligands:
glucosamine - 5/20
cobalamin - 5/20
FMN - 3/20
 RS: URS0000AB486F_608534
MFE: -40.991
Ligand: glucosamine
Species: Oribacterium sp. oral taxon 078 str. F0262 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000ABCA16_1352
MFE: -32.914
Ligand: glucosamine-6-phosphate
Species: Enterococcus faecium glmS
 RS: URS000056CE6D_1097677
MFE: -62.544
Ligand: FMN
Species: Clavibacter michiganensis subsp. nebraskensis NCPPB 2581 miscellaneous RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA079606 URS0000AB486F_608534 URS0000ABCA16_1352 URS000056CE6D_1097677
Length 149. 149. 148. 148.
Similarity - 0.964 0.962 0.959
Ensemble Norm 0.773 - - -
MFE -39.256 -40.991 -32.914 -62.544
Ligands - glucosamine glucosamine-6-phosphate FMN
Gene PHF19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 2.002 12.
Length SE - 0. 1. 1.
Lev Distance - 45. 49. 48.
UBS 10. 10. 10. 12.
BS 0. 0. 0. 0.
ILL 2. 4. 3. 3.
ILR 3. 2. 4. 5.
H 2. 2. 2. 3.
BL 4. 3. 4. 3.
BR 3. 4. 3. 2.
UN 0.074 0.047 0.027 0.061

Sequences

Field Description
UTR seq + 25 accaguaagucguguauuuagcauucauucaucaaagccuccggaugccuccuacgugcccugcacuaugcuggucuugguaauccguggucccuaucccagcgcccagugucaggggaagcugATGCTGGTCTTGGTAATCCGTGGTC
UTR dot + 25 ((((((((((.((((((.(((….(((((…………)))))….))).))))…))))).)))))))………((((((……..((((.(.((((((((((……)))))))))).)))))….))))))..
RS 1 seq ACGGGCCGCAUAGCGCCGGGACCGGAGACGGUUGACGAGGCUGGCAGUGAUCGAAGGAUUCGGCGGAUGCUGCCACGGAGUAGUGAAUCGAAAGAGGGAAUGGAAAAAGCGGAAUCAAAACCGUAACAGAGCUUCUCUCACUCACCAGG
RS 1 dot .(((((.((((..(((((((.((…..(((((.((……….)))))))..)).))))))).)))).))).))((((…………(((((((……..((((……..))))……..)))))))))))……
RS 2 seq CCUUUUAGGAUAGCGCCAGGUCUGUGUAAACAGAUGACGAGGAGAGGGUUUAUCGAAAGAUUCGGCGGAUGGCCCUAGGGACUGCACUCUACAGAAAAUCCACAAAAAAUGUCUGCAAAGAUAAAACAAAAGGAUUUUCCUGCAGCUG
RS 2 dot (((..((((.((.((((.(((((.(((((((…………….))))).))..))))).))))..))..))))))).(((((…….((((((((……..(((((….)))))……..)))))))).)))))…
RS 3 seq CGCGUGCUGCCUCCCAUCCGGACUUUAACCGUCGGUCCCGGAAUCCCACCGGAUCGGCGGACGAGGCUUCCGGGGACCCGGUCGCGCAUCGUCCGUUCGCGGACUGUCACCGCCGGCUCGGAUUUCCACCGACCCCGGAGCACGUGUA
RS 3 dot .((((((((..(((…(((((((((..((((((((.((((…….))))))))))))..))))..))))))))..))).)))))…(((((….)))))…((((.((((.((((…….))))..)))).)…)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table