Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA079625 Similarity: 0.954 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA079625
Gene: PHF20
MFE: -27.879
ENS: 0.893
Length: 169.
Predicted Ligands:
Mg2+ - 9/20
TPP - 8/20
lysine - 1/20
 RS: URS0000D93C9A_1423828
MFE: -29.022
Ligand: Mg2+
Species: Lactobacillus kefiranofaciens subsp. kefirgranum DSM 10550 = JCM 8572 M-box riboswitch (ykoK leader)
 RS: URS0000AB3985_573729
MFE: -56.919
Ligand: TPP
Species: Myceliophthora thermophila ATCC 42464 TPP riboswitch (THI element)
 RS: URS0000ABA988_696281
MFE: -44.599
Ligand: Mg2+
Species: Desulfotomaculum ruminis DSM 2154 M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA079625 URS0000D93C9A_1423828 URS0000AB3985_573729 URS0000ABA988_696281
Length 169. 168. 170. 168.
Similarity - 0.954 0.954 0.953
Ensemble Norm 0.893 - - -
MFE -27.879 -29.022 -56.919 -44.599
Ligands - Mg2+ TPP Mg2+
Gene PHF20 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 9. 13.004
Length SE - 1. 1. 1.
Lev Distance - 60. 56. 55.
UBS 13. 13. 12. 11.
BS 0. 0. 2. 0.
ILL 4. 5. 3. 4.
ILR 6. 6. 5. 4.
H 2. 1. 2. 3.
BL 5. 5. 4. 3.
BR 3. 3. 4. 3.
UN 0.095 0.131 0.082 0.155

Sequences

Field Description
UTR seq + 25 cuggagcggcgcagccggaguggggccgugagcacgaguacacgagacaggauugagaaaggagagauucaaauugugacuucagauucaaaggcaauuaaaggaauuaaacgagaauaaaggcagccccguugaugacugaaaATGACAAAGCATCCACCTAACAGAC
UTR dot + 25 ….(((((.((.(((…(((..(((.(((((..((((.(((((….(((((………..)))))…)))))))))..).))))..)))..)………………))…))).)).)))))((((.((………..))))))…………
RS 1 seq CAAAUGAACUGUUAGGUGAGACUCCUACGUAAAUAUACGCUGACGCCCAGCAACAUCCAGAGAUGCCAACGGGUUAAACAGGCACUGUCGAGUUAAGGCUUUCCCCAGUCAGCUAGUUGAACAGACUUCACGUUACGUAGUGUUAAAACUGAACGACGAGUAUAAAUC
RS 1 dot ………(((..(((..(((..(((((((((..((.(((((((((….(((.((.(.((.((((………….)))))).).)))))..)))……..))))))))..)…………..)))))))).)))…)))..)))………….
RS 2 seq GAAUGCAUGAGCCGGUGCCAAUCCGGUUGCUGUCAGGCGUCUUCCGUCCCAAGCCUCUCCUCUGCAAGGCUCAGACCGCGAGAAGGCCUCGACAGCGCCGGAGCGGCUGAGAUUAUACGGCGUAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCUUCUUGUCUUC
RS 2 dot (((.(((((((((((((((..(((((.(((((((((((.((((.((((…(((((……….)))))..))).).))))..)))).))))))))))))..)))…….)).))))….(((…((((……))))…)))..)))))))))……..
RS 3 seq UAUUUUCUUCGUUAGGUGAGGCUUCUGCAUAGACAAAUGCCACUGCCCGGAAAUGUCGAGAGACGCUAACGGGUUAACAGGUUCUACCGGCUUAAGGUUUAAUCUAAUGUGGCUGGGACUCAAUCCCUAGCUAUGUAUGUGCCAAAGCUUGCACGAGUGGAGAAGGUU
RS 3 dot ………(((((((((((.(((..((.((((…..(((…(((((..(.((((….)))).)..)))))…..)))))))…))..))).)))).)))))))((((((((……..))))))))….(((((……..)))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table