Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA079759 Similarity: 0.983 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA079759
Gene: PHF5A
MFE: -26.294
ENS: 0.968
Length: 76.
Predicted Ligands:
SAM - 7/20
fluoride - 4/20
homocysteine - 4/20
 RS: URS0000BED72E_361041
MFE: -21.824
Ligand: SAM
Species: Devosia soli SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C87260_1112204
MFE: -32.269
Ligand: fluoride
Species: Gordonia polyisoprenivorans VH2 Fluoride riboswitch
 RS: URS000080DE9F_3702
MFE: -27.164
Ligand: TPP
Species: TPP-specific riboswitch from Arabidopsis thaliana (PDB 3D2G, chain B)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA079759 URS0000BED72E_361041 URS0000C87260_1112204 URS000080DE9F_3702
Length 76. 76. 76. 77.
Similarity - 0.983 0.983 0.982
Ensemble Norm 0.968 - - -
MFE -26.294 -21.824 -32.269 -27.164
Ligands - SAM fluoride TPP
Gene PHF5A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 0.017 2.004 2.017
Length SE - 0. 0. 1.
Lev Distance - 23. 23. 22.
UBS 4. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 1. 1. 1. 0.
BR 0. 0. 0. 0.
UN 0.039 0.171 0.105 0.169

Sequences

Field Description
UTR seq + 25 aggucggacggaaguucccgaagcuuccgguggccggcuuaguuaggagcuATGGCTAAACATCATCCTGATTTGA
UTR dot + 25 (((((((.((((((((…..))))))))….)))))))((((((((…(((……)))..))))))))…
RS 1 seq GUCCCGGUUAGUGGCGAUUUGGCCGGUCGCUUGCAGCCACUUUAAACAACUUGCUAAAGACCGUUUGGAGCCGGCC
RS 1 dot …((((((((…….))))))))………(((.((((((((..(((….)))…))))))))..))).
RS 2 seq UCGGCCGCGGGUGAUGGAUCUCGCCCGGGCCGCGCCGGCCCGAACCGCCGACAAGGCUGAUGGCUCCUGUUCCGAU
RS 2 dot .(((((.(((((((……))))))))))))((..((((……(((…..)))….))))..))…….
RS 3 seq GGGACCAGGGGUGCUUGUUCACAGGCUGAGAAAGUCCCUUUGAACCUGAACAGGGUAAUGCCUGCGCAGGGAGUGUC
RS 3 dot (((((…….(((((….)))))…….)))))……((((..((((……))))..))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table