Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA079875 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA079875
Gene: PHLDA2
MFE: -21.715
ENS: 0.885
Length: 81.
Predicted Ligands:
cobalamin - 12/20
SAM - 3/20
cyclic-di-GMP - 2/20
 RS: URS000232DF84_12908
MFE: -20.849
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000BE547F_1343158
MFE: -15.881
Ligand: SAM
Species: Saccharibacter sp. AM169 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000AB64CB_1223307
MFE: -35.176
Ligand: cobalamin
Species: Streptomyces sp. PVA 94-07 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA079875 URS000232DF84_12908 URS0000BE547F_1343158 URS0000AB64CB_1223307
Length 81. 81. 81. 81.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.885 - - -
MFE -21.715 -20.849 -15.881 -35.176
Ligands - cobalamin SAM cobalamin
Gene PHLDA2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 4.002 4.001
Length SE - 0. 0. 0.
Lev Distance - 19. 22. 23.
UBS 8. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 1.
ILR 2. 0. 1. 3.
H 2. 2. 2. 2.
BL 4. 4. 5. 4.
BR 2. 4. 3. 3.
UN 0.062 0.086 0.012 0.037

Sequences

Field Description
UTR seq + 25 agagccggcgccgucaccgcccgcauugccgcucccagucccgcgcucggcacgacATGAAATCCCCCGACGAGGTGCTAC
UTR dot + 25 .(((.(((((..((……..))..))))))))..(((.((.((.((((…((…….))..)))))).)).)))..
RS 1 seq GUACUGAAAUGCAUGGUGGGAAAUCAGUGUGUAAUUCAUUGGCUGUGCCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAU
RS 1 dot …..(((.((((((.(((….))).)))))).)))(((((.((.((..((..(((……))).)))))).)))))..
RS 2 seq GUAACCCACCCUCGUGAUUUGAUAGGCCGGCUUGCGGCGAGGUAAAAGAACAUGCGCUAAAGAGGCCCUGUUUCUCUCCCG
RS 2 dot ((((.((..(((.((……)))))..)).))))((.((((…..(((((.(.(((…..)))).))))).)))))).
RS 3 seq AGGGGAAGCCGGUGGGAAUCCGGCGCUGACCCGCAGCCGUGAGCCGCCCGCACCAUCGGGGCAGGCGCAGCCGGAAUGCCU
RS 3 dot .(((..((.((.(((….))).))))..)))(((.(((((.(((((((………)))).))).))..)))..)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table