Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080133 Similarity: 0.955 Similarity: 0.954 Similarity: 0.947
UTR: 5HSAA080133
Gene: PICALM
MFE: -47.452
ENS: 0.965
Length: 172.
Predicted Ligands:
Mg2+ - 7/20
TPP - 5/20
cobalamin - 3/20
 RS: URS0000BF4933_694068
MFE: -52.450
Ligand: TPP
Species: Fomitiporia mediterranea MF3/22 TPP riboswitch (THI element)
 RS: URS0000C746F5_47500
MFE: -39.101
Ligand: Mg2+
Species: Aneurinibacillus migulanus M-box riboswitch (ykoK leader)
 RS: URS0000C2079D_436010
MFE: -62.964
Ligand: TPP
Species: Fibulorhizoctonia sp. CBS 109695 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080133 URS0000BF4933_694068 URS0000C746F5_47500 URS0000C2079D_436010
Length 172. 173. 171. 172.
Similarity - 0.955 0.954 0.947
Ensemble Norm 0.965 - - -
MFE -47.452 -52.450 -39.101 -62.964
Ligands - TPP Mg2+ TPP
Gene PICALM - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11. 4.007 30.003
Length SE - 1. 1. 0.
Lev Distance - 54. 59. 57.
UBS 11. 12. 10. 13.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 4.
ILR 3. 3. 4. 7.
H 2. 2. 3. 2.
BL 1. 4. 2. 4.
BR 3. 4. 3. 3.
UN 0.081 0.092 0.164 0.023

Sequences

Field Description
UTR seq + 25 cagcaacgugucggguuuucggaguagagauaaacaaaaccaggugacauuuccaagccucucaaggaaaggggggaaaaaaccuuucugggugucaccggcucugccguauccaagacaguaugcaaggccacgacccacgagaucATGTCCGGCCAGAGCCTGACGGACC
UTR dot + 25 ……(((((((((((((((((((((((……….((.((((((((((………….(((((((……….)))))))))))))))))))))))))….)))……….).)))))).))))..)))…….(((((..(((…))).))))).
RS 1 seq CUUUAUGGCUGCGGGUAUCCGGUUGUAAUGGCACUGCUUCUUGUUUUCCCCUGCUGGAUGUAUGUAGCACAUCUGGCUUUGUGAGCACAGCAGUUCCUUGCACUGGGUUGAGAUUAUACCGCUAGAACCUGAUCAGUGCUCAGACCUGCGUAGGGAAGCCCCCAGUGUCGUCG
RS 1 dot …….(((((((((((((((.(((((.((.((((((…(((((.(….(((((((((…….)))))))))…).))))).)))))).)))))))))))))………………)))))..))))…..((((((….(((….)))))).)))….
RS 2 seq AUGAAUCUUCGUUAGGUGAGGCUCCUAUACAAACAUAGGCCACUGCCCAGAAAUAUCGAAAGAUGCCCAUGGGUAGAACAGGGAUUGUCGGAUUAAGGCUUUUCCUAAUGUGGCUAAGAGAUGAUUUCUCUUUACGGUGUAUAGUGCUAAAACUCGACUAGGAGGGAACGG
RS 2 dot ……((.(((((((.((((((((…((((……….(((((((….((((….))))….)))))))……..)))).)))…..))))).))))))).))((((((((…..))))))…))……………(((……)))…….
RS 3 seq UGGAAUGGCUGCGGGUAUCCUCGUUUGUGAAUGCAACGCCCCUCACUUCCUGGUGGUCGUGGACAGACCGCCAGGUCGACCGAAGGCAUUGCAAACGCAGCGAGGGUUGAGAUCAUACCGCUUGAACCUGAACAGCGCUCAUACCUGCGUAGGGAAGCCCCCAGUCUCGCUU
RS 3 dot .((.((((((((((((((((((((.((((..(((((.(((..((.(..((((((((((…….))))))))))..)…)).))).)))))..))))))))))))………………)))))..))))…))).)).(((..(((…..)))…..)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table