Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080156 Similarity: 0.966 Similarity: 0.966 Similarity: 0.963
UTR: 5HSAA080156
Gene: PIGA
MFE: -38.462
ENS: 0.987
Length: 140.
Predicted Ligands:
cobalamin - 12/20
SAM - 5/20
FMN - 2/20
 RS: URS000232B80C_291594
MFE: -69.477
Ligand: cobalamin
Species: Micromonospora rifamycinica Cobalamin riboswitch
 RS: URS0000C35520_1246626
MFE: -38.
Ligand: SAM
Species: Bacillus lehensis G1 SAM riboswitch (S box leader)
 RS: URS000232ECEE_642780
MFE: -72.632
Ligand: cobalamin
Species: Marmoricola sp. Sco-D01 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080156 URS000232B80C_291594 URS0000C35520_1246626 URS000232ECEE_642780
Length 140. 138. 140. 138.
Similarity - 0.966 0.966 0.963
Ensemble Norm 0.987 - - -
MFE -38.462 -69.477 -38. -72.632
Ligands - cobalamin SAM cobalamin
Gene PIGA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 8. 2.001
Length SE - 4. 0. 4.
Lev Distance - 38. 42. 44.
UBS 12. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 4. 3. 5. 4.
ILR 5. 4. 3. 4.
H 2. 2. 1. 2.
BL 4. 3. 3. 5.
BR 4. 5. 4. 4.
UN 0. 0.065 0. 0.036

Sequences

Field Description
UTR seq + 25 gggugaaaccgacccgguucgaagcccggaaguugggucggagggucuccagaguaauagaggacacaucucuuaacuggguugcucuaagaacugaugucuaaaccgucucagcATGGAACTCACCGGGATCGATTTGC
UTR dot + 25 ((((..(((((…)))))….))))(.(((((((.((((.((((.(((((((…….(((((((..(((((…((….)).)))))..)).)))))…….)))….)))))))).))))..))))))).)
RS 1 seq UCGACAUCCGGUGCGCCGGGUGCUCAACUGCAUACGUCCCGUGUGGGGGGAAGCCGGUAGAGGCCGGCGCUGACCCGCAACCGUGAGCGAGGGGUCCUCUCGCGAGCCGGAAUGCCCCGCCCGGGACGAGCGGCUUCC
RS 1 dot ..(((((((((….))))))).))..((((…(((((((.((((((.(…((((((((((((..((((.((……..)).))))..))..)))))…..)))))..).)))))).))))))).))))…..
RS 2 seq CUCUUAUCGAGAGUUGGCUGAGGGAUUUGGCCCUUUGACGCCCAGCAACCGACCGUCCGUAUACCAUUUUAUGGAAACCUCUUAGAAGGUGCAAGGCACGGUGCUACAUCCAACAGGUUAAAUCACCUGAGAGAUAAGAG
RS 2 dot ((((((((………((.((((((((((((..(((……(((…..(((((((…((((.(((((.(((….))))))))))))…)).))))))))…..)))..))))))))).))).)).))))))))
RS 3 seq GUGAGGAUGCCCUCACCGGGUACGUGAACACGUGGUCCCCGUGCGGGGGAAGCCGGACCGAAGCCGGCGCUGACCCGCAACCGUGGGUCGUCCUGCGGGACGGCGAGCCGGAACGCCUGCCGGGGGCGACACCCCAUC
RS 3 dot ((((((….)))))).((((……….((.(((((((.(((((.(…((((..((..(((.(((.((((((((….))))))))…))).)).)..))..))))..).)))))))))))).))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table