Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080173 Similarity: 0.985 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA080173
Gene: PIGF
MFE: -9.686
ENS: 0.997
Length: 69.
Predicted Ligands:
fluoride - 14/20
cobalamin - 4/20
glutamine - 2/20
 RS: URS0000BFC384_1574623
MFE: -15.501
Ligand: glutamine
Species: Lyngbya confervoides BDU141951 Glutamine riboswitch
 RS: URS0000D81CD9_89059
MFE: -15.292
Ligand: fluoride
Species: Lactobacillus acidipiscis Fluoride riboswitch
 RS: URS0000BEF3A6_121723
MFE: -11.526
Ligand: fluoride
Species: Photobacterium sp. SKA34 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080173 URS0000BFC384_1574623 URS0000D81CD9_89059 URS0000BEF3A6_121723
Length 69. 67. 68. 68.
Similarity - 0.985 0.984 0.983
Ensemble Norm 0.997 - - -
MFE -9.686 -15.501 -15.292 -11.526
Ligands - glutamine fluoride fluoride
Gene PIGF - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 3. 1.
Length SE - 4. 1. 1.
Lev Distance - 15. 20. 21.
UBS 4. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 1. 1. 2.
H 2. 2. 2. 2.
BL 1. 2. 0. 0.
BR 0. 1. 0. 0.
UN 0.333 0.299 0.353 0.338

Sequences

Field Description
UTR seq + 25 ugggccgcccgucguaccugaugcuagccauccaagaaaacaccATGAAAGATAACGATATCAAGAGAC
UTR dot + 25 ((((..((.(((((….)))))…))..))))…………….((((….))))…….
RS 1 seq AUCGUUCAUCCAGCCAGUUUUUUGGCCAGGACGGAAGUAAGGGAAAGUUUCUCUGAAGGAACGCGCC
RS 1 dot ….(((.(((.(((((….)))))..))).)))………..((((((….))))))…..
RS 2 seq AUGUUUUCUGGUGAUGACGUUCACCAGUCCAAAAAUCCGUGCUCCCACGUAAUGACGUCUAAGUGAAU
RS 2 dot …….(((((((……)))))))………….(((…((((….))))…)))….
RS 3 seq AUUAUGGCGGGAGAUGAUGUUCCUCCUUAAACCGCCUUUCAAUCAAGGAUAAUGACGUCUAACAACAU
RS 3 dot …..((((((((..(……)..)))…)))))……….((((……))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table