Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080186 Similarity: 0.969 Similarity: 0.968 Similarity: 0.966
UTR: 5HSAA080186
Gene: PIGF_0
MFE: -38.068
ENS: 0.982
Length: 130.
Predicted Ligands:
SAM - 6/20
TPP - 6/20
cobalamin - 3/20
 RS: URS0000C81A9E_253703
MFE: -40.786
Ligand: SAM
Species: Paenibacillus antarcticus SAM riboswitch (S box leader)
 RS: URS0000AB9CC7_12908
MFE: -27.881
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C32727_1684385
MFE: -57.495
Ligand: Mn2+
Species: Novosphingobium sp. ST904 yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080186 URS0000C81A9E_253703 URS0000AB9CC7_12908 URS0000C32727_1684385
Length 130. 129. 131. 130.
Similarity - 0.969 0.968 0.966
Ensemble Norm 0.982 - - -
MFE -38.068 -40.786 -27.881 -57.495
Ligands - SAM cobalamin Mn2+
Gene PIGF - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 6. 3.004
Length SE - 1. 1. 0.
Lev Distance - 39. 39. 44.
UBS 11. 10. 10. 10.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 3.
ILR 2. 1. 2. 2.
H 3. 3. 3. 4.
BL 2. 3. 4. 2.
BR 4. 4. 3. 3.
UN 0.077 0.132 0.084 0.015

Sequences

Field Description
UTR seq + 25 ggccgcccgucguaccugaugguaggaggcaguaguuccccgcuucccuuccgcgggagggagaguuagguaacuggauuuuugaaaugcuguaucuacuuucuuATGAAAGATAACGATATCAAGAGAC
UTR dot + 25 ….(((..((.((((….)))).)))))..(((((((..((((.((((((…)))))).))))..)).)))))..(((((((…….(((((((((((….))))).))..)))))))))))..
RS 1 seq AUCUUAUCAAGAGCAGGUGGAGGGACAGGCCCGAUGAAACCCGGCAACCGGCGUUUAAUAAACGUACGGUGCUAAUUCUUGCAGGAAGAUUUGUCGAAUUGUUGGCAAAUCCUUCUUGAGAGAUGAGAG
RS 1 dot …(((((..(.((..((……))..))).)))))…..(((.((((((((((…)))))).)))))))…((((.((((((((((((((((….)))))))))).)))))).))))……
RS 2 seq AUACUGAAAAGCAUGGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUUCCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAUAGACCCCUGUCGAAUGAUGGCCAGGAAAAGCCUAAUUCUACAAUACUUAA
RS 2 dot ….((((…((((.(((….))).))))…)))).((((.(((((.((………)).)))))))))…(((((…….(((.((((…(((……..)))..)))).))))))))…
RS 3 seq CGGCUUGUCAUCUGGGGAGUAGCCGCCUGCGCCCCUUGCCCCGGCCAUCGCCCGGACAAGACCAGCAGGACCUGUCGUCAACAUACUUGGUCGAGAGACCAUGGCGCACAGGAGGACGGAAAAUCCGUCC
RS 3 dot (((((..((…….))..)))))(((((….((((.((.(((….))).)).))))….))))).((((((((((…….(((((….)))))))))).))))).(((((((…)))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table