Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080226 Similarity: 0.983 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA080226
Gene: PIGO
MFE: -21.030
ENS: 0.520
Length: 71.
Predicted Ligands:
cobalamin - 14/20
fluoride - 6/20

 RS: URS0002320AC6_546414
MFE: -24.943
Ligand: cobalamin
Species: Deinococcus deserti VCD115 Cobalamin riboswitch
 RS: URS0000D87156_1895733
MFE: -19.215
Ligand: fluoride
Species: Burkholderiales bacterium 70-64 Fluoride riboswitch
 RS: URS0000BE364E_1210046
MFE: -19.436
Ligand: cobalamin
Species: Janibacter hoylei PVAS-1 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080226 URS0002320AC6_546414 URS0000D87156_1895733 URS0000BE364E_1210046
Length 71. 70. 71. 69.
Similarity - 0.983 0.982 0.981
Ensemble Norm 0.520 - - -
MFE -21.030 -24.943 -19.215 -19.436
Ligands - cobalamin fluoride cobalamin
Gene PIGO - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16.003 6. 3.008
Length SE - 1. 0. 4.
Lev Distance - 16. 22. 20.
UBS 7. 5. 6. 6.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 0. 0.
H 3. 3. 3. 3.
BL 4. 1. 2. 3.
BR 2. 1. 2. 3.
UN 0.113 0.171 0.127 0.203

Sequences

Field Description
UTR seq + 25 aggucgcaggcgccgccgccgccgcacuuccgggugccauugcaggATGCAGAAAGCCTCAGTGTTGCTCT
UTR dot + 25 .(((.((.(((…))))).)))(((((….)))))(((((.(((.(……).))))))))…….
RS 1 seq GGGAAGUCCGGUGAGAUUCCGGCGCUGUCGCGCAACGGUAUGCAGGCCCUGACCUGCGAGCCCGAAUACC
RS 1 dot ((((..((….))..)))).((((….))))…(((.((((((……)))))).)))……..
RS 2 seq UUGGACGAGGGAGAUGGCAUUCCUCCCGCAUUCGCGAAACCGCCGCAACGGCUGAUGAUGCCUGCACCGCC
RS 2 dot ..(((.(.(((((………))))).).)))(((….))).(((..(((…….))))))……
RS 3 seq GAGGAAUCCGGUGCAACUCCGGAGCGGUCCCGCCACUGUCACGGCCCACGCGGCCCGAGCCAGACACUC
RS 3 dot ……(((((…….)))))(((….)))..(((.(.(((.((….)).))).).)))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table