Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080275 Similarity: 0.985 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA080275
Gene: PIGW
MFE: -20.437
ENS: 0.826
Length: 80.
Predicted Ligands:
zmp-ztp - 9/20
SAM - 4/20
homocysteine - 3/20
 RS: URS0000BF57F5_1660103
MFE: -20.493
Ligand: SAM
Species: Kaistia sp. SCN 65-12 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000C2AFA1_272562
MFE: -16.998
Ligand: zmp-ztp
Species: Clostridium acetobutylicum ATCC 824 ZMP/ZTP riboswitch
 RS: URS0000D7BC72_1960125
MFE: -16.996
Ligand: SAM
Species: Parendozoicomonas haliclonae SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080275 URS0000BF57F5_1660103 URS0000C2AFA1_272562 URS0000D7BC72_1960125
Length 80. 79. 81. 79.
Similarity - 0.985 0.984 0.984
Ensemble Norm 0.826 - - -
MFE -20.437 -20.493 -16.998 -16.996
Ligands - SAM zmp-ztp SAM
Gene PIGW - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 4.001 3.006
Length SE - 1. 1. 1.
Lev Distance - 17. 19. 20.
UBS 4. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 2. 0. 1. 1.
ILR 2. 2. 2. 1.
H 2. 2. 2. 2.
BL 0. 1. 1. 0.
BR 0. 1. 1. 1.
UN 0.263 0.291 0.296 0.342

Sequences

Field Description
UTR seq + 25 acguagaccgucugcugggggcgccggcaccauuuggaguacgugaggaagaaaaATGTCTGAAAAGCAGATGAAGGAAG
UTR dot + 25 (((((..(((..((((((…..))))))…..)))..)))))………….(((((…..)))))……..
RS 1 seq UGGCUGUCCCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCACGUAAAAUAAAUCGCUAAAAAGGCCGAGGAUGACAAGUU
RS 1 dot (((((((.(((((((……))))..)))…)))))))………..(((((…..))).))…………
RS 2 seq AGAAAAUCAUGCAACUGGCGGAAAUGGAGUUCACCAUAGGGAGCAUGAUUAAUAUAAGAAUCGACCGCCUGGGUAAAUUAA
RS 2 dot ….((((((((..((((.(((…….))).)))…)..))))))))………….(((…..)))…….
RS 3 seq CUUCGGUCAGGCGCUGAUUUGUUACUUCGGCUUGCGGGCGCUUAAUAAAUACCGCUAAAGAGAUAGUGGACGUCUAUCC
RS 3 dot …..(((..(((((((………)))))..)).)))…………((((((……))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table