Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080336 Similarity: 0.990 Similarity: 0.988 Similarity: 0.987
UTR: 5HSAA080336
Gene: PIK3C3
MFE: -17.563
ENS: 0.870
Length: 63.
Predicted Ligands:
fluoride - 18/20
cobalamin - 2/20

 RS: URS0000DB1040_560556
MFE: -24.178
Ligand: cobalamin
Species: Asanoa sp. 210121 Cobalamin riboswitch
 RS: URS0000D7ABA7_1955065
MFE: -23.894
Ligand: cobalamin
Species: Streptomyces sp. M41(2017) Cobalamin riboswitch
 RS: URS0000BF524F_390874
MFE: -26.779
Ligand: fluoride
Species: Thermotoga petrophila RKU-1 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080336 URS0000DB1040_560556 URS0000D7ABA7_1955065 URS0000BF524F_390874
Length 63. 62. 64. 64.
Similarity - 0.990 0.988 0.987
Ensemble Norm 0.870 - - -
MFE -17.563 -24.178 -23.894 -26.779
Ligands - cobalamin cobalamin fluoride
Gene PIK3C3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 0.003 3.011
Length SE - 1. 1. 1.
Lev Distance - 11. 15. 16.
UBS 4. 3. 4. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 3. 3. 3.
BL 1. 0. 1. 0.
BR 1. 0. 1. 0.
UN 0.206 0.210 0.156 0.312

Sequences

Field Description
UTR seq + 25 aaguucccgcuguaggugguaccuuugcagacggugcgATGGGGGAAGCAGAGAAGTTTCACT
UTR dot + 25 ……(((((…)))))..((.(((((…..))))).))..(((((……)))))…
RS 1 seq GGAAGCCGGUGAGAUACCGGCACGGUCGCGCCACUGUGACCACGCUUGCGUGGAAGUCAGAC
RS 1 dot ….(((((((…)))))))..((((((……))))))..((((……))))…..
RS 2 seq GAGAAGCCGGUGCAAAUCCGGCGCUGACCCGCAACCGUGAGCCGCUUCGGCGGUGAGCCGGAUC
RS 2 dot …..(((((…….)))))(((.((……..)).)))…((((((…..))))))..
RS 3 seq AACCCAACGGGCGAUGAGGCCCGCCCAAACUGCCCUGAAGAGGGCUGAUGGCCUCUACUGGCUU
RS 3 dot …….(((((……)))))……..(((((….)))))….((((……)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table