Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080516 Similarity: 0.974 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA080516
Gene: PITPNB
MFE: -32.032
ENS: 0.901
Length: 112.
Predicted Ligands:
methionine - 6/20
glycine - 4/20
TPP - 2/20
RS: URS0000DA4813_1718947
MFE: -54.109
Ligand: methionine
Species: Micromonospora sp. CB01531 S-adenosyl methionine (SAM) riboswitch,
RS: URS0000DB3844_2021862
MFE: -42.125
Ligand: TPP
Species: Labrenzia sp. VG12 TPP riboswitch (THI element)
RS: URS0000B508D6_396013
MFE: -35.196
Ligand: Ni/Co
Species: Oceanicola marinus TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080516 URS0000DA4813_1718947 URS0000DB3844_2021862 URS0000B508D6_396013
Length 112. 112. 111. 111.
Similarity - 0.974 0.974 0.974
Ensemble Norm 0.901 - - -
MFE -32.032 -54.109 -42.125 -35.196
Ligands - methionine TPP Ni/Co
Gene PITPNB - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15. 9.001 8.
Length SE - 0. 1. 1.
Lev Distance - 27. 29. 30.
UBS 11. 12. 11. 11.
BS 0. 0. 0. 0.
ILL 3. 3. 1. 3.
ILR 6. 4. 4. 4.
H 1. 1. 1. 1.
BL 4. 7. 5. 6.
BR 4. 3. 4. 4.
UN 0.071 0.062 0.045 0.081

Sequences

Field Description
UTR seq + 25 agcugugaggggguuccgggaagauggugcugaucaaggaauugugagugggucugugggcgcgagcgaggccgugggacggcagugATGGTGCTGATCAAGGAATTCCGTG
UTR dot + 25 …….(.((((((((..(((((((.(((((.(((.((..((((..(((……….)))..))))..)).)))..))))).)….)).))..))..)))))))).).
RS 1 seq GGUCAUGAGCGCCAGCGCCAAGCCCCGGCUCGCUGGCCGGCAACCCUCCUCCGCGGUGGGGUGCCCCGGGUGAGGACCAGGCAUCGGCAGCACGCCGGUGCAAGCGUGGCCU
RS 1 dot …….((.((((.(((…((.(((((..((((.((((…((.((((((.(((.((….))))).).)))))…))..))))))))..))))).))..)))))))))
RS 2 seq GGCGUCUCAUGGGGGUGCCCGGCCAUUCCGGAUCGGGCUGAGAGGCAGCCUGCCAACUCCUUGAACCUGAUCCGGCUGAUACCGGCGGAGGGACUUGAGAUCAUGACACUU
RS 2 dot …((.((((((((((.(((.((((((((((((((((.(..((((.((……..))))))..)))))))))))..)))…))).).)).))))….)))))).))..
RS 3 seq GCGGCUACCUCGGGGUGUCCUGGCCGAUGUGCGCAGGACUGAGAUGCGUGAUGCGAACCCGUUGAACCUGAUCCGGUUAAUACCGGCGGAGGGAUGGUCGGACAGCCGGGA
RS 3 dot ……..(((((..(((((.(((((.(.(.(((.((((((.(((..((…(((….)))…))…)))))))…..)).))).).)..)))))))))).))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table