Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080646 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA080646
Gene: PKD2L2
MFE: -33.113
ENS: 0.911
Length: 81.
Predicted Ligands:
homocysteine - 5/20
zmp-ztp - 4/20
TPP - 4/20
 RS: URS0000C84168_1455
MFE: -23.435
Ligand: glycine
Species: Bacillus badius Glycine riboswitch
 RS: URS000231FF35_560556
MFE: -33.203
Ligand: zmp-ztp
Species: Asanoa sp. 210121 ZMP/ZTP riboswitch
 RS: URS0000D8FED5_1122188
MFE: -28.419
Ligand: homocysteine
Species: Lysobacter spongiicola DSM 21749 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080646 URS0000C84168_1455 URS000231FF35_560556 URS0000D8FED5_1122188
Length 81. 81. 82. 81.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.911 - - -
MFE -33.113 -23.435 -33.203 -28.419
Ligands - glycine zmp-ztp homocysteine
Gene PKD2L2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 11.001 9.
Length SE - 0. 1. 0.
Lev Distance - 21. 17. 19.
UBS 7. 7. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 1. 0. 1. 1.
H 2. 2. 2. 2.
BL 1. 2. 4. 3.
BR 3. 3. 4. 1.
UN 0.037 0.025 0. 0.049

Sequences

Field Description
UTR seq + 25 gcgcgcaagcgccgcggccucaggcgaacgaacgggcgguguagugcagguccgccATGGCTGAGGCGTCACGGTGGCACC
UTR dot + 25 ..((((..(((((((..((((……..))..))))))))).)))).((((((((.((((……)))).))))).)))
RS 1 seq GGAGCAGCUUCUGGAGAGACCGCGGGAAUUCCGCGGCGCCGAAGGGUUCACAAUCUCAGGCAAAAGGACAGAAGAGUAUUG
RS 1 dot .((((..((((.((…(.((((((…..))))))).)))))).)))).(((((((…………….))).))))
RS 2 seq GGGGGUGAGUGCGACUGGCGGCACGGGAUGGCAGUGACCAUCGGGGAGCCCGCCGUGGGUAUCGACCGCCUGGGUGCCCACG
RS 2 dot (.((((…(.(((.(((…(((.(…..).))).)))))).)..)))).)((((((((((………))))))))))
RS 3 seq UUCGCCGAGGGGCGCUGCGACCGCCAUGAUCAAGUGCGGCCAGGCUCGGCGCGGCUUCACGUACAACGGCGCCCGGUUGUU
RS 3 dot ..((((((…((.(((.(.(((((……..).))))))))))))))))(((((…(((……)))…)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table