Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080699 Similarity: 0.970 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA080699
Gene: PKN2
MFE: -19.871
ENS: 0.860
Length: 141.
Predicted Ligands:
TPP - 9/20
molybdenum - 4/20
cobalamin - 4/20
 RS: URS0000C756BD_858640
MFE: -33.627
Ligand: TPP
Species: Photobacterium jeanii TPP riboswitch (THI element)
 RS: URS00005CED08_509170
MFE: -29.887
Ligand: glycine
Species: Acinetobacter baumannii SDF Glycine
 RS: URS0000C06F44_1078085
MFE: -34.302
Ligand: TPP
Species: Paenisporosarcina sp. HGH0030 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080699 URS0000C756BD_858640 URS00005CED08_509170 URS0000C06F44_1078085
Length 141. 141. 141. 140.
Similarity - 0.970 0.964 0.964
Ensemble Norm 0.860 - - -
MFE -19.871 -33.627 -29.887 -34.302
Ligands - TPP glycine TPP
Gene PKN2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.013 6. 8.008
Length SE - 0. 0. 1.
Lev Distance - 38. 46. 44.
UBS 9. 9. 7. 9.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 4.
ILR 2. 4. 2. 4.
H 4. 4. 4. 3.
BL 2. 1. 1. 1.
BR 1. 0. 1. 2.
UN 0.206 0.092 0.184 0.114

Sequences

Field Description
UTR seq + 25 auuuuuaaaaaauucuuuaagcuccuacuggaccauaaacuaaauuuuaaguaacuagggagagaaauacuacugacauuaauagaagacuacacaugacgaaaagaugaacauggATGGCGTCCAACCCCGAACGGGGGG
UTR dot + 25 …((((((……))))))((((..((((….((((……))))…..))))))))………………….((.(.(((..((((………….))))..)))).))…((((…..)))).
RS 1 seq ACGUUCUCAUUGGGGAGCUAGCCUAAGAAGAUACUUGUUAGCCAACAAACAACAUCUUAGGUUGACGCUGAGAUUGCAUACGCAGAACCCACAGAACCUGAACCAGCUAAUACUGGCGUAGGAAUUGAGAAGUCGCUGAUC
RS 1 dot ..((((((….))))))((((((((((……(((((….)))))……))))))))))..((…….))….((.((…..(((..((((..((((……))))..))))..)))…..))))…..
RS 2 seq AAAAUCUGGAGAGCAGCUUAAGAUUUAUAAGCAUGGAGAAUAAAAACUUAUAAGUCAUAAACUCACCGAAGGGGAAGAUCGAAAUACUAAAAGGUAGUAUUUAGGUCGAAACUCUCAGGUACAAAUGACAGAUGGGCUGUA
RS 2 dot …..(((…..)))…..((((((((((……………))))))))))……..(((..((((…((((.((((((((…..)))))))).))))….))))..)))…….((((…..)))).
RS 3 seq AUCUUCCACUAGGGGGACCUUGCAAUUGAUAAAUGGAAAUCAUUUAUUCAUUAAAUAAAGGUUGAGAUUAAAGUAAUGCUUUAAGACCCUUAGAACCUGAUCUGGUUUAUACCAGCGUAGGGAAGUGGAGUUGCGGAGCA
RS 3 dot ..(((((….)))))(((((..(((.((((((((…..)))))))).)))…..)))))…………..((((((..(((((……((((..(((((….)))))..))))…..)).)))..))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table