Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080751 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA080751
Gene: PKP3
MFE: -38.941
ENS: 0.833
Length: 101.
Predicted Ligands:
purine - 20/20 - 20/20


 RS: URS0000AB354B_264732
MFE: -29.646
Ligand: purine
Species: Moorella thermoacetica ATCC 39073 Purine riboswitch
 RS: URS0000ABB51E_398579
MFE: -15.507
Ligand: purine
Species: Shewanella pealeana ATCC 700345 Purine riboswitch
 RS: URS0000C2CAC2_35841
MFE: -18.204
Ligand: purine
Species: Bacillus thermoamylovorans Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080751 URS0000AB354B_264732 URS0000ABB51E_398579 URS0000C2CAC2_35841
Length 101. 102. 100. 102.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.833 - - -
MFE -38.941 -29.646 -15.507 -18.204
Ligands - purine purine purine
Gene PKP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.024 5.040 2.038
Length SE - 1. 1. 1.
Lev Distance - 22. 22. 24.
UBS 6. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 1. 1. 1.
H 3. 3. 3. 3.
BL 2. 3. 1. 2.
BR 2. 3. 1. 2.
UN 0.059 0.216 0.260 0.255

Sequences

Field Description
UTR seq + 25 ggccucgagggacaggacgugaagauaguuggguuuggaggcggccgccaggcccaggcccgguggaccugccgccATGCAGGACGGTAACTTCCTGCTGT
UTR dot + 25 ((((…………………….(((((((((.((…)).))))))))))))).(((((…..)))))..((((((.(….).))))))…
RS 1 seq CAAUAAAGCCAGUCUUAACUUCGUAUAUCCCCGGCAAUAGGGACCGGGGGUUUCUACCAGGCAACCGCAAAUUGCCCGGCUACGAAGGUAUAUCUUCGUUGC
RS 1 dot ………………….(((.(((((((((……).))))))))…)))(.(((((…….))))).)((.((((((……)))))).))
RS 2 seq UAAUAUUUACCGUUAACACUUCGUAUAAUCUCAAUGAUAUGGUUUGAGAGUUUCUACCAAGAGCCCUAAACUCUUGAUUAUGAAGACUUUACUUUAUGUA
RS 2 dot ………………….(((.((((((((………))))))..)).)))((((((…….))))))..(((((((……)))))))..
RS 3 seq UAAAAACUAAUAACAAAUACUCGUAUAAUUUCGGGAAUAUGGCCCGAGAGUUUCUACCGAGCUACCACAAAUAGCUUGACUACGAGGUAUGAAUCAUGGAUU
RS 3 dot ………………….(((.(((((((((…….)))))))..)).)))(((((((…….))))))).(((.((……..)).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table