Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080981 Similarity: 0.974 Similarity: 0.973 Similarity: 0.971
UTR: 5HSAA080981
Gene: PLCB4
MFE: -37.295
ENS: 0.973
Length: 125.
Predicted Ligands:
TPP - 7/20
cobalamin - 5/20
molybdenum - 2/20
 RS: URS0000C3199A_1262761
MFE: -35.669
Ligand: TPP
Species: Butyrivibrio sp. CAG:318 TPP riboswitch (THI element)
 RS: URS0000AB79A0_12908
MFE: -23.208
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000D8D365_1802180
MFE: -33.153
Ligand: molybdenum
Species: Spirochaetes bacterium GWC1_61_12 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080981 URS0000C3199A_1262761 URS0000AB79A0_12908 URS0000D8D365_1802180
Length 125. 126. 125. 125.
Similarity - 0.974 0.973 0.971
Ensemble Norm 0.973 - - -
MFE -37.295 -35.669 -23.208 -33.153
Ligands - TPP cobalamin molybdenum
Gene PLCB4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 12.002 9.006
Length SE - 1. 0. 0.
Lev Distance - 27. 31. 35.
UBS 10. 11. 9. 11.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 1.
ILR 4. 5. 4. 2.
H 2. 2. 2. 3.
BL 5. 2. 2. 6.
BR 3. 4. 2. 2.
UN 0.120 0.135 0.160 0.

Sequences

Field Description
UTR seq + 25 agggagcccuccggaguucgggagcagcacguugugaggguccacacaagggugaugccagaccgaacaccauuagggccugggugucuugaauauaaucATGGCCAAACCTTATGAATTTAACT
UTR dot + 25 ..((.(((((..((.((((((..(((.(((.(((((……..)))))..))).)))….)))))).))…)))))))(((((((.(((……))).)))…))))………….
RS 1 seq ACAGUUUGCUAGGGGCGCUGGAUGAGUCCGGCUGAGAGGAAACCACUCUAAUGUUUCGACCCUUGGGACAACUGUCCCAUACCUGAUCCGGGUAAUGCCGGCGUAGGGAUGUAUAUCAUAUAAUAC
RS 1 dot (((((((.(((((((((..(.((((((((……..)))…..)))..)).)..)).))))))).).))))))..((..((((..((((……))))..))))..))……………
RS 2 seq AUAUUGUCGGUGGGAAAUUAGUGUGAAAUUCACUUGCUGUUCCUGCAACGGUUAAAGUCCGAAUGCCACCCAAUAAAGUCCGCUGUGAAUGAAGGCCAGGAAAAGUCUAAUUCUACAAUGAAAAA
RS 2 dot …….(((((((..(((.(.(((..((((((((((((((…..))))))..))))..))))..)))).)))….))))))).((((..((((……..)))).))))…………
RS 3 seq UCUCAGUGUCAUCUCCGAGUUUCACUGGACCUACAGCUGGUGGGCAGCCAUGGCCGGAAACCGAUGAGCCGCAGGCGAAAGGCUGCGACUUCCCGUAUUUGGAAAGGAACAUGACCAUGAACAAC
RS 3 dot …..((.(((((((((.((..((.(((.(((((…..)))))…)))))))))))….)))))))(((((.(….).))))).(((.(((….))).)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table