Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA080998 Similarity: 0.983 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA080998
Gene: PLCE1
MFE: -22.608
ENS: 0.774
Length: 94.
Predicted Ligands:
TPP - 7/20
glycine - 5/20
zmp-ztp - 3/20
 RS: URS0000D85C67_889453
MFE: -27.776
Ligand: TPP
Species: Bacteroidales bacterium SC/BZ-SP2 TPP riboswitch (THI element)
 RS: URS0000C45BF2_1236989
MFE: -25.964
Ligand: TPP
Species: Geofilum rubicundum JCM 15548 TPP riboswitch (THI element)
 RS: URS0000DA2831_310780
MFE: -43.783
Ligand: zmp-ztp
Species: Streptomyces rubidus ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA080998 URS0000D85C67_889453 URS0000C45BF2_1236989 URS0000DA2831_310780
Length 94. 95. 95. 93.
Similarity - 0.983 0.982 0.982
Ensemble Norm 0.774 - - -
MFE -22.608 -27.776 -25.964 -43.783
Ligands - TPP TPP zmp-ztp
Gene PLCE1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 3.
Length SE - 1. 1. 1.
Lev Distance - 21. 21. 22.
UBS 7. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 1.
ILR 1. 1. 2. 1.
H 3. 3. 3. 3.
BL 3. 2. 2. 2.
BR 2. 1. 1. 3.
UN 0.085 0.105 0.063 0.086

Sequences

Field Description
UTR seq + 25 acccugcacguugcaggauuuuucacugugauuugagauugggcuucauucagugggucguggugauuaATGGTTTCAGAAGGAAGTGCAGCAG
UTR dot + 25 ..((((((…))))))…(((((……..)))))(((.(((((.(((..((((.(((……..)))..))))))).))))).)))…
RS 1 seq UUUCCUACAAUGGGGUGCCUUAAUACAAAGGGCUGAGAUCAUACCCUCUGAACCUGACCGGGUAAUGCCGGUAAGGGAAAGUAUAUCUCCUAAUA
RS 1 dot ..(((((…))))).(((((…….))))).(((((.((((..((….(((.(((((……))))).)))))..)))))))))……
RS 2 seq UAUUCUACAAUGGGGUGCCCUCAAUAAUCGGGCUGAGAUCAUACCCUCUGAACCUGGUCGGGUAAUGCCGACAAGGGAAAGUGUUUAUCUCCAAC
RS 2 dot .((((((…))))))((((………)))).(((((.((((..((….(((.(((((……))))).)))))..))))..)))))….
RS 3 seq ACGGCGAGCCGUGACUGGCGCGCAGGGAUGGGGUCAACCAUCGGGGAGCGGCUCGUCGCCACCACACAUGUGCCGUGCGCCUGGGCCGUCCCG
RS 3 dot …(((.((((….)))).)))…(((((……))))).((((.(((((((..((((((((….)))..))).)).))))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table